METHOD AND KIT FOR DETECTION OF A TARGET NUCLEIC ACID SEQUENCE

专利摘要:
nucleic acid target sequence detection by pto cleavage and extension-dependent signaling oligonucleotide hybridization assay the present invention relates to the detection of a nucleic acid target sequence by pce-sh assay (pto-cleavage and hybridization of extension-dependent signaling oligonucleotides). the present invention does not use probes to be hybridized to target nucleic acid sequences to provide target signals. interestingly, the present invention uses probes (signaling oligonucleotides) to be hybridized with the extended strand formed in a target dependent manner in which the extended strand is synthesized using the artificially selected cto as a model.
公开号:BR112014018940B1
申请号:R112014018940-4
申请日:2012-07-03
公开日:2021-03-23
发明作者:Joug Yoon Chun；Young Jo Lee
申请人:Seegene, Inc.；
IPC主号:

专利说明:

[0001] [0001] The present invention relates to the detection of a target nucleic acid sequence by a PCE-SH assay (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization). DESCRIPTION OF RELATED TECHNIQUE
[0002] [0002] DNA hybridization is a fundamental process in molecular biology, and is affected by ionic resistance, base composition, length of fragment to which the nucleic acid has been reduced, the degree of mismatch, and the presence of denaturing agents. The technologies based on DNA hybridization would be a very useful tool in the determination of specific nucleic acid sequence, and would clearly be valuable in clinical diagnosis, genetic research, and forensic laboratory analysis.
[0003] [0003] However, conventional methods and processes highly dependent on hybridization are very likely to produce false positive results due to non-specific hybridization between probes and non-target sequences. Therefore, problems remain to be solved to improve its reliability.
[0004] [0004] In addition to probe hybridization processes, several approaches using additional enzymatic reactions, for example, TaqMan ™ probe method, have been suggested.
[0005] [0005] In the TaqMan ™ probe method, the labeled probe hybridized to a target nucleic acid sequence is cleaved by a 5 'nuclease activity of an upstream primer-dependent DNA polymerase, generating a signal indicating the presence of a target sequence (United States Patent Nos. 5,210,015, 5,538,848 and 6,326,145). The TaqMan ™ probe method suggests two approaches to signal generation: polymerization-dependent cleavage and polymerization-independent cleavage. In polymerization-dependent cleavage, the extension of the upstream primer must occur before a nucleic acid polymerase meets the 5 'end of the labeled probe. As the extension reaction continues, the polymerase progressively cleaves the 5 'end of the labeled probe. In the polymerization-independent cleavage, the upstream primer and the labeled probe are hybridized to a target nucleic acid sequence in excellent proximity, such that the binding of the nucleic acid polymerase to the 3 'end of the upstream primer brings it into contact with the 5 'end of the probe labeled to release the label. In addition, the TaqMan ™ probe method describes that the probe labeled at its 5 'end having a 5-tail region not hybridizable to a target sequence, is also cleaved to form a fragment comprising the 5-tail region '.
[0006] [0006] Some methods have been reported in which a probe having a 5 'tail region not complementary to a target sequence is cleaved by 5' nucleasse, to release a fragment comprising the 5 'tail region.
[0007] [0007] For example, United States Patent No. 5,691,142 describes a cleavage structure to be digested by the 5 'DNA polymerase nuclease activity. The cleavage structure is exemplified, in which an oligonucleotide comprising a 5 'portion not complementary to, and a 3' portion complementary to a model, is hybridized to the model, and an upstream oligonucleotide is hybridized to the model in excellent proximity. The cleavage structure is cleaved by DNA polymerase having 5 'nuclease activity, or modified DNA polymerase with reduced synthetic activity to release the 5' portion not complementary to the model. The released 5 'portion is then hybridized to an oligonucleotide having a hairpin structure to form a cleavage structure, thereby inducing progressive cleavage reactions to detect a target sequence.
[0008] [0008] United States Patent No. 7,381,532 describes a process in which the cleavage structure having the upstream oligonucleotide with blocked 3 'end is cleaved by DNA polymerase having 5' nuclease activity, or FEN nuclease to release non-complementary 5 'flap region, and the released 5' flap region is detected by size analysis or interactive double tag. United States Patent No. 6,893,819 describes that released detectable tabs are produced by a sequential amplification method mediated by nucleic acid synthesis-dependent tab. In this method, a flap released from a first cleavage structure cleaves in a manner dependent on nucleic acid synthesis, a second cleavage structure to release a flap from the second cleavage structure, and the released flaps are detected.
[0009] [0009] By hybridizing fluorescence-labeled probes to a liquid phase, a plurality of target nucleic acid sequences can be simultaneously detected using even a single type of a fluorescent tag by melting curve analysis. However, conventional technologies for detecting target sequences by 5 'nuclease-mediated cleavage of double interactive labeled probes require different types of fluorescent tags for different target sequences in multiplex target detection, which limits the number of target sequences to be used. detected due to limited number of fluorescent label types.
[0010] [00010] United States Patent Application Publication 2008-0241838 describes a method of target detection using cleavage of a probe having a 5 'portion not complementary to a target nucleic acid sequence, and hybridization of a capture probe. A label is positioned on the 5 'non-complementary portion. The labeled probe hybridized to the target sequence is cleaved to release a fragment, after which the fragment is then hybridized to the capture probe to detect the presence of the target sequence. In this method, it is necessary that an uncleaved / intact probe is not hybridized with the capture probe. For this, the capture probe having a shorter length has to be immobilized on a solid substrate. However, such a limitation results in lower hybridization efficiency on a solid substrate, and also difficulties in optimizing the reaction conditions.
[0011] [00011] Therefore, there remain very felt needs in the art to develop new approaches for detecting a target sequence, preferably multiple target sequences, in a liquid phase, and in a solid phase, for not only hybridization, but also enzymatic reactions , such as 5 'nucleotyl reaction in a more convenient, safe and reproducible manner. In addition, a new method of target detection not limited by the number of types of labels (particularly, fluorescent labels) is also required in the art.
[0012] [00012] Therefore, there remain very felt needs in the art to develop new approaches for detecting a target nucleic acid sequence in a more convenient, safe and reproducible way, which is able to be free from the problems of conventional technologies.
[0013] [00013] Through this application, several patents and publications are referenced, and citations are provided in parentheses. The description of these patents and publications in their entirety are, therefore, incorporated by references in this application in order to fully describe this invention and the state of the art to which this invention belongs. SUMMARY OF THE INVENTION
[0014] [00014] The present inventors have provided intensive research to develop new approaches to detect target sequences with improved accuracy and convenience, among others, in a multiplex manner. As a result, new protocols for target sequence detection have been established, in which target detection is carried out by enzymatic reactions, such as 5 'nucleolytic reaction and extension and extension-dependent hybridization, as well as probe hybridization. The present protocols are well adopted for liquid phase reactions, as well as solid phase reactions, and ensure detection of multiple target sequences with improved precision and convenience.
[0015] [00015] Consequently, it is an objective of this invention to provide a method for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids, by a PCE-SH assay (PTO Cleavage and Hybridization of Oligonucleotide of Extension Dependent Signaling).
[0016] [00016] It is another object of this invention to provide a kit for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids by a PCE-SH assay.
[0017] [00017] Other objectives and advantages of the present invention will become apparent from the detailed description below taken in conjunction with the appended claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] [00018] Fig. 1 shows the schematic structures of PTO (Probing and Labeling Oligonucleotide), CTO (Capture and Modeling Oligonucleotide) and SO (Signaling Oligonucleotide) used in a PCE-SH (PTO Cleavage) assay and Hybridization of Extension-Dependent Signaling Oligonucleotides). Preferably, the 3 'ends of the PTO, CTO and SO are blocked to prevent their extension.
[0019] [00019] Fig. 2 schematically represents the PCE-SH assay using an interactive double interlining tag. The SO has a reporter molecule and a suppressor molecule.
[0020] [00020] Fig. 3 schematically represents the PCE-SH assay using a single label. The OS has a reporter molecule as a single tag. The reporter molecule is required to show different signal strength, depending on its presence in a single-stranded or double-stranded form.
[0021] [00021] Fig. 4 schematically represents the PCE-SH assay using an interactive double inter-interfacing tag and two SOs. The two SOs each comprise a tag between a reporter molecule and an interactive double tag suppressor molecule.
[0022] [00022] Fig. 5 schematically represents the PCE-SH assay using an interactive double interlining tag. The SO comprises a reporter molecule and the extended filament comprises a suppressor molecule.
[0023] [00023] Fig. 6 schematically represents the PCE-SH assay using an interactive double-interfacing tag. The SO comprises a reporter molecule and the extended filament comprises iso-dG residue of the suppressor incorporated during the extension reaction.
[0024] [00024] Fig. 7 schematically represents the PCE-SH assay using an interactive double interfacing tag. The SO comprises a reporter molecule and the extended filament comprises suppressor dA residues incorporated during the extension reaction.
[0025] [00025] Fig. 8 schematically represents the PCE-SH assay using intercalating dyes. The OS comprises an acceptor. Green SYBR is used as donors.
[0026] [00026] Fig. 9 schematically represents the PCE-SH assay for detecting a nucleotide variation.
[0027] [00027] Fig. 10A shows the results of the real-time detection of Neisseria gonorrhoeae gene by PCE-SH assay. The SO has a reporter molecule and a suppressor molecule.
[0028] [00028] Fig. 10B shows the results of the detection of Neisseria gonorrhoeae gene by PCE-SH assay comprising steps for a fusion analysis. The SO has a reporter molecule and a suppressor molecule.
[0029] [00029] Fig. 11A shows the results of the real-time detection of Neisseria gonorrhoeae gene by PCE-SH assay with PCR amplification. The SO has a reporter molecule and a suppressor molecule.
[0030] [00030] Fig. 11B shows the results of the detection of Neisseria gonorrhoeae gene by PCE-SH assay comprising steps for post-PCR fusion analysis. The SO has a reporter molecule and a suppressor molecule.
[0031] [00031] Fig. 12 shows the results of detecting a single nucleotide variation of a target nucleic acid sequence by PCE-SH assay comprising steps for post-PCR fusion analysis. The C677T mutation in the MTHFR (Methylenetetrahydrofolate reductase) gene was detected.
[0032] [00032] Fig. 13A shows the results of the real-time detection of Neisseria gonorrhoeae gene by PCE-SH assay using upstream oligonucleotide-independent 5 'nuclease activity.
[0033] [00033] Fig. 13B shows the results of the detection of Neisseria gonorrhoeae gene by PCE-SH assay comprising steps for a fusion analysis using upstream oligonucleotide-independent 5 'nuclease activity. DETAILED DESCRIPTION OF THIS INVENTION
[0034] (a) hibridizar a sequência de ácido nucleico alvo com um oligonucleotídeo a montante e um oligonucleotídeo de sondagem e de etiquetagem (PTO); em que o oligonucleotídeo a montante compreende uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo; o PTO compreende (i) uma porção de direcionamento-3’ compreendendo uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo, e (ii) uma porção de etiquetagem-5’ compreendendo uma sequência de nucleotídeo não complementar à sequência de ácido nucleico alvo; em que a porção de direcionamento-3’ do PTO é hibridizada com a sequência de ácido nucleico alvo, e a porção de etiquetagem-5’ não é hibridizada com a sequência de ácido nucleico alvo; o oligonucleotídeo a montante está localizado á montante do PTO; (b) contatar a resultante da etapa (a) a uma enzima tendo uma atividade de nuclease 5’ sob condições para clivagem do PTO; em que o oligonucleotídeo a montante, ou seu filamento estendido, induz clivagem do PTO pela enzima tendo a atividade de nuclease 5’, tal que a clivagem libera um fragmento compreendendo a porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO; (c) hibridizar o fragmento liberado a partir do PTO com um oligonucleotídeo de captura e de modelagem (CTO); no qual o CTO compreende em uma direção 3’ a 5’, (i) uma porção de captura compreendendo uma sequência de nucleotídeo complementar à porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO, e (ii) uma porção de modelagem compreendendo uma sequência de nucleotídeo não complementar à porção de etiquetagem-5’, e a porção de direcionamento-3’ do PTO; no qual o fragmento liberado a partir do PTO é hibridizado com a porção de captura do CTO; (d) realizar uma reação de extensão usando a resultante da etapa (c) e uma polimerase de ácido nucleico dependente do modelo; no qual o fragmento hibridizado com a porção de captura do CTO é estendido para formar um filamento estendido compreendendo uma sequência estendida complementar à porção de modelagem do CTO, formando, desse modo, um duplex estendido; (e) hibridizar o filamento estendido com um oligonucleotídeo de sinalização (SO); no qual o SO compreende uma sequência complementar ao filamento estendido, e pelo menos uma etiqueta; o SO proporciona um sinal detectável por hibridização com o filamento estendido; e (f) detectar o sinal; pelo que a detecção do sinal indica a presença do filamento estendido, e a presença da sequência de ácido nucleico alvo. [00034] In one aspect of the present invention, there is provided a method for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids by a PCE-SH assay (PTO Cleavage and Hybridization of Oligonucleotide of Extension-dependent Signaling), comprising: (a) hybridizing the target nucleic acid sequence with an upstream oligonucleotide and a probing and tagging oligonucleotide (PTO); wherein the upstream oligonucleotide comprises a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprises (i) a 3 'targeting portion comprising a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5' tagging portion comprising a nucleotide sequence not complementary to the acid sequence target nucleic; wherein the 3 'targeting portion of the PTO is hybridized to the target nucleic acid sequence, and the 5' labeling portion is not hybridized to the target nucleic acid sequence; the upstream oligonucleotide is located upstream of the PTO; (b) contacting the resultant from step (a) to an enzyme having a 5 'nuclease activity under conditions for cleavage of the PTO; wherein the upstream oligonucleotide, or its extended strand, induces cleavage of the PTO by the enzyme having the 5 'nuclease activity, such that the cleavage releases a fragment comprising the 5' labeling portion, or a part of the labeling portion- 5 'from the PTO; (c) hybridize the fragment released from the PTO with a capture and modeling oligonucleotide (CTO); in which the CTO comprises in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and ( ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion, and the 3' targeting portion of the PTO; in which the fragment released from the PTO is hybridized to the capture portion of the CTO; (d) carrying out an extension reaction using that resulting from step (c) and a model-dependent nucleic acid polymerase; in which the fragment hybridized to the capture portion of the CTO is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; (e) hybridizing the extended strand with a signaling oligonucleotide (SO); in which the SO comprises a sequence complementary to the extended filament, and at least one tag; the SO provides a detectable signal by hybridization with the extended filament; and (f) detecting the signal; whereby the detection of the signal indicates the presence of the extended strand, and the presence of the target nucleic acid sequence.
[0035] [00035] The present inventors have carried out intensive research to develop new approaches to detect target sequences with more improved precision and convenience, among others, in a multiplex way. As a result, new protocols for the detection of target sequences have been established, in which the detection of the target is carried out by enzymatic reactions, such as 5 'nucleolytic reaction and extension and extension-dependent hybridization, as well as probe hybridization. The present protocols are well adopted for liquid phase reactions, as well as solid phase reactions, and ensure detection of multiple target sequences with improved precision and convenience.
[0036] [00036] The present invention employs successive events followed by probe hybridization; cleavage and extension of PTO (Probing and Labeling Oligonucleotide); and hybridization of extension-dependent signaling oligonucleotides. Therefore, it is called a PCE-SH assay (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization).
[0037] [00037] The PCE-SH assay will be described in more detail as follows: Step (a): Hybridization of an upstream oligonucleotide and a PTO with a target nucleic acid sequence
[0038] [00038] In accordance with the present invention, a target nucleic acid sequence is first hybridized with an upstream oligonucleotide and a PTO (Probing and Labeling Oligonucleotide).
[0039] [00039] The term used herein "target nucleic acid", "target nucleic acid sequence" or "target sequence" refers to a nucleic acid sequence of interest for detection, which is annealed to, or hybridized with, a probe or initiator under conditions of hybridization, annealing, or amplification.
[0040] [00040] The term used herein "probe" refers to a single-stranded nucleic acid molecule comprising a portion or portions that are substantially complementary to a target nucleic acid sequence.
[0041] [00041] The term "primer", as used herein, refers to an oligonucleotide, which is capable of acting as a point of initiation of synthesis when placed under conditions in whose primer extension product synthesis which is complementary to a filament nucleic acid (model) is induced, that is, in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at an appropriate temperature and pH.
[0042] [00042] Preferably, the probe and primer are single-stranded deoxyribonucleotide molecules. The probes or primers used in this invention can be comprised of naturally occurring dNMP (i.e., dAMP, dGM, dCMP and dTMP), modified nucleotide, or unnatural nucleotide. The probes or primers can also include ribonucleotides.
[0043] [00043] The initiator must be long enough to initiate the synthesis of extension products in the presence of the agent for polymerization. The exact length of the initiators will depend on many factors, including temperature, application, and source of initiator. The term "ringing" or "priming" as used herein refers to the apposition of an oligodeoxynucleotide or nucleic acid to a model nucleic acid, so the apposition enables the polymerase to polymerize nucleotides into a nucleic acid molecule that is complementary to the acid model nucleic, or a portion thereof.
[0044] [00044] The term "hybridization" used herein refers to the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization can occur between two strands of nucleic acid perfectly matched or substantially matched with some mismatches. Complementarity for hybridization may depend on hybridization conditions, particularly temperature.
[0045] [00045] Hybridization of a target nucleic acid sequence with the upstream oligonucleotide and PTO can be performed under suitable conditions of hybridization routinely determined by optimization procedures. Conditions such as temperature, component concentration, hybridization and washing times, buffer components, and their pH and ionic resistance, can be varied depending on several factors, including the length and GC content of the oligonucleotide (upstream oligonucleotide and PTO) , and the target nucleotide sequence. For example, when a relatively short oligonucleotide is used, it is preferable that stringent conditions are adopted. Detailed conditions for hybridization can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).
[0046] [00046] There is no intended distinction between the terms "annealing" and "hybridization", and these terms will be used interchangeably.
[0047] [00047] The upstream oligonucleotide and PTO have hybridization of nucleotide sequences complementary to the target nucleic acid sequence. The term "complementary" is used here to mean that primers or probes are sufficiently complementary to selectively hybridize to a target nucleic acid sequence under designated ringing conditions, or stringent conditions, involving the terms "substantially complementary" and "perfectly complementary" , preferably perfectly complementary.
[0048] [00048] The 5 'labeling portion of the PTO has a nucleotide sequence not complementary to the target nucleic acid sequence. The modeling portion of the CTO (Capture and Modeling Oligonucleotide) has a nucleotide sequence not complementary to the labeling portion-5 'and the targeting portion-3' of the PTO. The term "non-complementary" is used here to mean that primers or probes are sufficiently non-complementary not to selectively hybridize to a target nucleic acid sequence under designated ringing conditions, or stringent conditions, involving the terms "substantially non-complementary" and "perfectly non-complementary", preferably, perfectly non-complementary.
[0049] [00049] For example, the term "non-complementary", together with the 5 'labeling portion of the PTO, means that the 5' labeling portion is non-complementary enough not to selectively hybridize to a target nucleic acid sequence under designated ringing conditions, or stringent conditions, involving the terms "substantially non-complementary" and "perfectly non-complementary", preferably perfectly non-complementary.
[0050] [00050] The term used herein "PTO (Probing and Labeling Oligonucleotide)" means an oligonucleotide comprising (i) a 3 'targeting portion that serves as a probe, and (ii) a 5' labeling portion with a nucleotide sequence not complementary to the target nucleic acid sequence, which is nucleolytically released from the PTO after hybridization to the target nucleic acid sequence. The labeling portion-5 'and the targeting portion-3' on the PTO must be positioned in an order 5 'to 3'. The PTO is schematically illustrated in Fig. 1.
[0051] [00051] Preferably, the hybridization in step (a) is performed under stringent conditions that the 3 'targeting portion is hybridized to the target nucleic acid sequence, and the 5' labeling portion is not hybridized to the targeting sequence. target nucleic acid.
[0052] [00052] The PTO does not require any specific lengths. For example, the length of the PTO can be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20 -60 nucleotides, 20-50 nucleotides, 30-150 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-50 nucleotides, 35-100 nucleotides, 35-80 nucleotides, 35-60 nucleotides, or 35-50 nucleotides. The 3 'targeting portion of the PTO can be of any length, considering that it is specifically hybridized to target nucleic acid sequences. For example, the 3 'targeting portion of the PTO may be 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15 -50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides or 20-30 nucleotides in length. The labeling portion-5 'can be of any length, considering that it is specifically hybridized to the modeling portion of the CTO and then extended. For example, the 5 'tagging portion of the PTO can be 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10 -20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides, in length.
[0053] [00053] The 3 'end of the PTO may have a 3'-OH terminal. Preferably, the 3 'end of the PTO is "locked" to prevent preventing its extension.
[0054] [00054] Blocking can be achieved according to conventional methods. For example, blocking can be accomplished by adding to the 3'-hydroxyl group the last nucleotide of a chemical moiety, such as biotin, tags, a phosphate group, an alkyl group, non-nucleotide linker, phosphorothioate, or alkane diol. Alternatively, blocking can be effected by removing the 3'-hydroxyl group from the last nucleotide, or using a nucleotide with no 3'-hydroxyl group, such as dideoxynucleotide.
[0055] [00055] Alternatively, the PTO can be designed to have a hairpin structure.
[0056] [00056] Non-hybridization between the 5 'labeling portion of the PTO and the target nucleic acid sequence refers to the non-formation of a stable double strand between them under certain hybridization conditions. According to one embodiment, the 5 'labeling portion of the PTO not involved in hybridization to the target nucleic acid sequence, forms a single strand.
[0057] [00057] The upstream oligonucleotide is located upstream of the PTO.
[0058] [00058] In addition, the upstream oligonucleotide, or its extended strand hybridized to the target nucleic acid sequence, induces cleavage of the PTO by an enzyme having a 5 'nuclease activity.
[0059] [00059] Induction of PTO cleavage by the upstream oligonucleotide can be carried out in two ways: (i) induction of cleavage regardless of the extent of the upstream oligonucleotide; and (ii) induction of cleavage depending on the extent of the upstream oligonucleotide.
[0060] [00060] Where the upstream oligonucleotide is positioned adjacent to the PTO sufficient to induce PTO cleavage by an enzyme having a 5 'nuclease activity, the enzyme bound to the upstream oligonucleotide digests the PTO with no extension reaction. In contrast, where the upstream oligonucleotide is positioned distant from the PTO, an enzyme having polymerase activity (eg, model-dependent polymerase) catalyzes the extension of the upstream oligonucleotide (eg, upstream primer), and an enzyme having the 5 'nuclease activity linked to the extended product digests the PTO.
[0061] [00061] Therefore, the upstream oligonucleotide can be located relative to the PTO in two modes. The upstream oligonucleotide may be located adjacent to the PTO sufficient to induce PTO cleavage in a manner independent of the extent.
[0062] [00062] Alternatively, the upstream oligonucleotide may be located far enough away from the PTO to induce PTO cleavage in an extent-dependent manner.
[0063] [00063] The term used here "adjacent" with reference to positions or locations means that the upstream oligonucleotide is located adjacent to the 3 'targeting portion of the PTO to form a nick. Also, the term means that the upstream oligonucleotide is located 1-30 nucleotides, 1-20 nucleotides or 115 nucleotides apart from the 3 'targeting portion of the PTO.
[0064] [00064] The term used here "distant" with reference to positions or locations, includes any positions or locations sufficient to ensure extension reactions.
[0065] [00065] According to one embodiment, the upstream oligonucleotide is located distant from the PTO sufficient to induce PTO cleavage in an extent-dependent manner.
[0066] [00066] According to one embodiment, the upstream oligonucleotide is an upstream primer, or an upstream probe. The upstream primer is suitable for an extension-independent cleavage induction, or an extension-dependent cleavage, and the upstream probe is suitable for an extension-independent cleavage induction.
[0067] [00067] Alternatively, the upstream oligonucleotide may have a partial overlapping sequence with the 5 'part of the 3' targeting portion of the PTO. Preferably, the overlapping sequence is 1-10 nucleotides, more preferably, 1-5 nucleotides, even more preferably, 1-3 nucleotides, in length. Where the upstream oligonucleotide has a partial overlapping sequence with the 5 'part of the targeting portion-3' of the PTO, the targeting portion-3 'is partially digested along with the labeling portion-5' in the cleavage reaction of the step (b). In addition, the overlapping sequence allows to cleave a desired site from the 3 'targeting portion.
[0068] [00068] According to one embodiment, the upstream primer induces, through its extended filament, the cleavage of the PTO by the enzyme having the 5 'nuclease activity.
[0069] [00069] Conventional technologies for upstream oligonucleotide cleavage reactions can be applied to the present invention, considering that the upstream oligonucleotide induces cleavage of the PTO hybridized to the target nucleic acid sequence to release a fragment comprising the labeling portion -5 ', or part of the PTO-5' labeling portion. For example, United States Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069 and 7,381,532 and United States Order Publication No. 2008-0241838, can be applied to the present invention.
[0070] [00070] According to one embodiment, the method is carried out in the presence of a downstream initiator. The downstream primer additionally generates a target nucleic acid sequence to be hybridized with the PTO, intensifying the sensitivity in a target detection.
[0071] [00071] According to one embodiment, when the upstream and downstream primers are used, a model-dependent nucleic acid polymerase is additionally employed for extending the primers.
[0072] [00072] According to one embodiment, the upstream oligonucleotide (upstream primer, or upstream probe), the downstream primer and / or PTO-5 'labeling portion, have a double priming oligonucleotide (DPO) structure ) developed by the present inventor. Oligonucleotides having the DPO structure show significantly improved target specificity compared to conventional primers and probes (see WO 2006/095981; Chun et al., Dual priming oligonucleotide system for the detection of respiratory virus multiplex and SNP genotyping of CYP2C19 gene, Nucle / c Acid Research, 35: 6e4O (20 <X7)).
[0073] [00073] According to one embodiment, the 3 'targeting portion of the PTO has a specified double-specific oligonucleotide (mDSO) structure developed by the present inventor. The oligonucleotide structure of specified double specificity (mDSO) shows significantly improved target specificity compared with conventional probes (see WO 2011/028041). Step (b): Release a fragment from PTO
[0074] [00074] Then, the resultant from step (a) is contacted with an enzyme having a 5 'nuclease activity under conditions for cleavage of the PTO. The PTO hybridized to the target nucleic acid sequence is digested by the enzyme having 5 'nuclease activity to release a fragment comprising the 5' labeling portion, or a part of the 5 'labeling portion.
[0075] [00075] The term used here "conditions for PTO cleavage" means sufficient conditions to digest the PTO hybridized to the target nucleic acid sequence by the enzyme having 5 'nuclease activity, such as temperature, pH, ionic resistance, buffer, length and sequence of oligonudeotides and enzymes. For example, when Taq DNA polymerase is used as the enzyme having 5 'nuclease activity, conditions for PTO cleavage include Tris-HCl, KCl, MgCl2 buffer, and temperature.
[0076] [00076] When the PTO is hybridized to the target nucleic acid sequence, its targeting portion-3 'is involved in hybridization, and the labeling portion-5' forms a single strand with no hybridization to the target nucleic acid sequence (see Fig. 2). As such, an oligonucleotide, comprising both single-stranded and double-stranded structures, can be digested using an enzyme having a 5 'nuclease activity by a variety of technologies known to one skilled in the art.
[0077] [00077] PTO cleavage sites are varied depending on the type of upstream oligonucleotides (upstream probe, or upstream primer), upstream oligonucleotide hybridization sites, and cleavage conditions (see United States Patent Nos. 5,210 .015, 5,487,972, 5,691,142, 5,994,069 and 7,381,532, and United States Order Publication No. 2008-0241838).
[0078] [00078] A multiplicity of conventional technologies can be employed for the PTO cleavage reaction, releasing a fragment comprising the 5 'labeling portion, or a 5' labeling portion portion.
[0079] [00079] Soon, there may be three cleavage sites in step (b). First, the cleavage site is a junction site between a hybridization portion of the PTO (targeting portion-3 ') and a non-hybridizing portion (labeling portion-5'). The second cleavage site is a site located several nucleotides in a 3 'direction apart from the 3' end of the 5 'labeling portion of the PTO. The second cleavage site is located at the terminal-5 'part of the targeting-3' portion of the PTO. The third cleavage site is a site located several nucleotides in a 5 'direction apart from the 3' end of the 5 'labeling portion of the PTO.
[0080] [00080] According to one embodiment, the initial site for cleavage of the PTO by model-dependent polymerase having nuclease activity 5 'after extension of the upstream primer, is a starting point of the double filament between the PTO and the sequence of target nucleic acid, or a 1-3 nucleotide site apart from the starting point.
[0081] [00081] In connection with this, the term used here "a fragment comprising the 5 'tagging portion, or a part of the 5' tagging portion of the PTO", together with the cleavage of the PTO by the enzyme having the activity of 5 'nuclease, is used to enclose (i) the 5' tag portion, (ii) the 5 'tag portion, and the 5' end portion of the 3 'target portion, and (iii) a part of the 5 'labeling portion. In this application, the term "a fragment comprising the 5 'labeling portion, or a part of the 5' labeling portion", can also be described as "PTO fragment".
[0082] [00082] The term "part", used in conjunction with the PTO or CTO, such as the part of the labeling portion-5 'of the PTO, the terminal part-5' of the targeting portion-3 'of the PTO, and the 5 'terminal part of the CTO capture portion, refers to a nucleotide sequence composed of 1-40, 1-30, 1-20, 1-15, 1-10 or 1-5 nucleotides, preferably 1.2 , 3 or 4 nucleotides.
[0083] [00083] According to one embodiment, the enzyme having the 5 'nuclease activity is DNA polymerase having a 5' nuclease activity or FEN nuclease, more preferably, a thermostable DNA polymerase having a 5 'nuclease activity, or FEN nuclease.
[0084] [00084] A suitable DNA polymerase having a 5 'nuclease activity in this invention is a thermostable DNA polymerase obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literati's, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17 , Thermotoga neapolitana, Thermosipho africanus, Thermococcus coastalis, 5 Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikosyrocyrus pyrocyrus Most preferably, the thermostable DNA polymerase is Taq polymerase.
[0085] [00085] Alternatively, the present invention can employ DNA polymerases having a 5 'nuclease activity modified to have less polymerase activities.
[0086] [00086] The FEN nuclease (flap endonuclease) used is a specific 5-flap nuclease.
[0087] [00087] The FEN nuclease suitable in the present invention comprises FEN nucleases obtained from a variety of bacterial species, including Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus coastalis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brieriyi, Acidianurususoccus, , Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix, and Archaeaglobus veneficus.
[0088] [00088] Where the upstream primer is used in step (a), it is preferable that the conditions for cleavage of the PTO understand the upstream primer extension reaction.
[0089] [00089] According to one embodiment, the upstream primer is used in step (a), a model-dependent polymerase is used to extend the upstream primer. The model-dependent polymerase can be identical to or different from the enzyme having 5 'nuclease activity.
[0090] [00090] Optionally, the upstream primer is used in step (a), a model-dependent polymerase is used to extend the upstream primer, and the model-dependent polymerase is different from the enzyme having 5 ’nuclease activity. Step (c): Hybridization of the fragment released from the PTO with CTO
[0091] [00091] The fragment released from the PTO is hybridized with a CTO (Capture and Modeling Oligonucleotide).
[0092] [00092] The CTO comprises in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and (ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion, and the 3' targeting portion of the PTO.
[0093] [00093] The CTO is acted as a model for extending the fragment released from the PTO. The fragment that serves as an initiator is hybridized to the CTO and extended to form an extended duplex.
[0094] [00094] The modeling portion can comprise any sequence, considering that it is not complementary to the labeling portion-5 'and the targeting portion-3' of the PTO. In addition, the modeling portion can comprise any sequence considering that the wing is acted as a model for extending the fragment released from the PTO.
[0095] [00095] As described above, when the fragment having the 5 'labeling portion of the PTO is released, it is preferred that the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the 5' labeling portion. When the fragment having the 5 'tag portion and a 5' terminal portion of the 3 'targeting portion is released, it is preferred that the CTO capture portion is designed to comprise a nucleotide sequence complementary to the labeling portion -5 'and the terminal-5' part of the targeting portion-3 '. When the fragment having a part of the 5 'tag portion of the PTO is released, it is preferred that the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the part of the 5' tag portion.
[0096] [00096] In addition, it is possible to designate the capture portion of the CTO in advance of the PTO cleavage sites. For example, where the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the 5 'labeling portion, or the fragment having a portion of the 5' labeling portion, or the fragment having the labeling portion- 5 ', can be hybridized to the capture portion and then extended. When the fragment comprising the 5 'tag portion and a 5' terminal portion of the 3 'targeting portion is released, it can be hybridized to the CTO capture portion designated to comprise the nucleotide sequence complementary to the 5 'tagging and then successfully extended, although mismatched nucleotides are present in the 3' end portion of the fragment. This is because the primers can be extended depending on the reaction conditions, although their 3 'end contains some mismatched nucleotides (for example, 1-3 mismatched nucleotides).
[0097] [00097] When the fragment comprising the labeling portion-5 'and a terminal portion-5' of the targeting portion-3 'is released, the terminal-5' portion of the capture portion of the CTO can be designated to have a sequence of complementary nucleotide to the 5 'terminal part cleaved from the 3' targeting portion, overcoming problems associated with mismatched nucleotides (see Fig. 1).
[0098] [00098] Preferably, the nucleotide sequence of the 5 'terminal part of the CTO capture portion complementary to the 5' terminal part cleaved from the 3 'targeting portion can be selected depending on the anticipated cleavage sites in the targeting portion- 3 'from the PTO. It is preferred that the nucleotide sequence of the 5 'terminal part of the CTO capture portion complementary to the 5' cleaved terminal part of the 3 'targeting portion is 1-10 nucleotides, more preferably 1-5 nucleotides, further preferably 1-3 nucleotides.
[0099] [00099] The 3 'end of the CTO may comprise additional nucleotides not involved in hybridization to the fragment. In addition, the capture portion of the CTO may comprise a nucleotide sequence complementary to only a part of the fragment (for example, a part of the fragment containing its 3 'end portion), considering that it is stably hybridized to the fragment.
[0100] [000100] The term used "capture portion comprising a nucleotide sequence complementary to the labeling portion-5 ', or a portion of the labeling portion-5'" is described herein to encompass various designs and compositions of the capture portion of the CTO , as discussed above.
[0101] [000101] The CTO can be designed to have a hairpin structure.
[0102] [000102] The length of the CTO can be widely varied. For example, the CTO is 7-1000 nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500 nucleotides , 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-1000 nucleotides, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides , 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, or 30-40 nucleotides, in length. The capture portion of the CTO can be of any length considering that it is specifically hybridized to the fragment released from the PTO. For example, the capture portion of the CTO is 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides, in length. The modeling portion of the CTO can be of any length, considering that it can act as a model in the extent of the fragment released from the PTO. For example, the modeling portion of the CTO is 1900 nucleotides, 1-400 nucleotides, 1-300 nucleotides, 1-100 nucleotides, 1-80 nucleotides, 1-60 nucleotides, 1-40 nucleotides, 1-20 nucleotides, 2- 900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5- 300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10-400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15- 100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides or 15-20 nucleotides, in length.
[0103] [000103] The 3 'end of the CTO can have a 3'-OH terminal. Preferably, the 3 'end of the CTO is blocked to prevent its extension. Non-extensible blocking of the CTO can be achieved according to conventional methods. For example, blocking can be accomplished by adding to the 3'-hydroxyl group the last nucleotide of the CTO, of a chemical fraction, such as biotin, tags, a phosphate group, alkyl group, non-nucleotide bond, phosphorothioate, or alkane- diol. Alternatively, blocking can be effected by removing the 3'-hydroxyl group from the last nucleotide, or using a nucleotide with no 3'-hydroxyl group, such as dideoxynucleotide.
[0104] [000104] The fragment released from the PTO is hybridized with the CTO, providing a suitable shape in the fragment extension. Although an undigested PTO is also hybridized to the capture portion of the CTO through its labeling portion-5 ', its targeting portion-3' is not hybridized to the CTO which prohibits the formation of an extended duplex.
[0105] [000105] The hybridization in step (c) can be described in detail with reference to the descriptions in step (a). Step (d): Fragment extension
[0106] [000106] The extension reaction is carried out using the resultant from step (c) and a model-dependent nucleic acid polymerase. The fragment hybridized to the capture portion of the CTO is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex. In contrast, non-cleaved PTO hybridized to the capture portion of the CTO is not extended such that no extended filament is formed.
[0107] [000107] The term used here "extended duplex" means a duplex formed by extension reaction in which the fragment hybridized to the capture portion of the CTO is extended using the modeling portion of the CTO as a model, and the nucleic acid polymerase dependent on the model.
[0108] [000108] The term used here "extended filament", together with the fragment means a sequence composed of the fragment and its extended sequence.
[0109] [000109] The term used here "extended sequence" in conjunction with the fragment means only a newly extended sequence which is a portion of the extended filament, except for the fragment.
[0110] [000110] The template-dependent nucleic acid polymerase used in step (d) can include any nucleic acid polymerases, for example, Klenow fragment of E. coil DNA polymerase I, a thermostable DNA polymerase and DNA polymerase Bacteriophage T7. Preferably, the polymerase is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literal's, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolocus, African thermothem, African continent Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus furiosus (Pfu), Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyss, Aquyrus More preferably, the model-dependent nucleic acid polymerase is Taq polymerase.
[0111] [000111] According to one embodiment, the model-dependent nucleic acid polymerase includes a reverse transcriptase.
[0112] [000112] According to one embodiment, the enzyme having the 5 'nuclease activity used in step (b) is identical to the model-dependent nucleic acid polymerase used in step (d). More preferably, the enzyme having the 5 'nuclease activity used in step (b), the model-dependent nucleic acid polymerase used for upstream primer extension, and the model-dependent nucleic acid polymerase used in step (d) , are identical to each other. Step (e): Signal generation by hybridization between the extended filament and SO
[0113] [000113] Following the extension reaction, the extended filament is hybridized with a signaling oligonucleotide (SO). The signal indicative of a presence of the target nucleic acid sequence is provided. The signal includes a signal generation or extinction, or signal change (signal increase or decrease).
[0114] [000114] The SO to be hybridized with the extended filament comprises a sequence complementary to the extended filament.
[0115] [000115] Where the SO comprises a sequence complementary only to the PTO fragment, a non-target signal cannot be generated due to the hybridization of undigested PTO and the SO in some of the signaling systems described here below.
[0116] [000116] Where the position of tags incorporated in the extended filament, as illustrated in Fig. 6, is properly adjusted, a non-target signal cannot be generated even using the SO comprising a sequence complementary only to the PTO fragment.
[0117] [000117] However, where the SO comprises a sequence complementary only to the PTO fragment, a non-target signal can be generated due to the hybridization of undigested PTO, and the SO in some signaling systems described here below (for example, the signaling system in Fig. 2).
[0118] [000118] Where the non-target signal becomes problematic, a portion of the SO must be designed to comprise a sequence complementary to a portion of the newly synthesized extended sequence.
[0119] [000119] According to a modality, the SO comprises a sequence complementary to the extended sequence.
[0120] [000120] According to one embodiment, at least a portion of the SO comprises a sequence complementary to the extended sequence. The portion of the SO comprising a sequence complementary to the extended sequence is at least one, two, three, four, five or ten nucleotides in length.
[0121] [000121] When a portion of the SO is designed to comprise a sequence complementary to a portion of the newly synthesized extended sequence, the Tm value of the hybridization resulting from the SO, and the extended filament, become different from those of the hybridization resulting from the SO and the Undigested PTO. The difference in the Tm values ensures to differentiate signals from the two resulting hybridizations. For example, non-target signals can be excluded in a real-time detection by adjusting the temperature to detect Tm values, or in a melting curve analysis by melting peaks.
[0122] [000122] Preferably, the SO can comprise, through all its complete sequence, a sequence complementary to the extended sequence. Alternatively, the SO may comprise a portion having a sequence complementary to the extended sequence. For example, a portion of the SO may comprise a sequence complementary to the extended sequence, and the other portion may comprise a sequence complementary to the fragment.
[0123] [000123] Preferably, the SO comprises, throughout its complete sequence, a sequence complementary to the extended sequence.
[0124] [000124] The SO can be any length, for example, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10 nucleotides, 10-100 nucleotides, 10- 80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30-nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 15 -20 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, or 20-30 nucleotides.
[0125] [000125] The OS can have a hairpin structure.
[0126] [000126] Preferably, the 3 'end of the OS is blocked to prevent its extension.
[0127] [000127] Alternatively, the SO having an unblocked 3'-OH end can be extended.
[0128] [000128] The signaling system adopted in the present invention is characterized by the association of signal generation with hybridization of the SO. In other words, after hybridization of the SO with the extended filament, a detectable signal is provided. Hybridization of the SO with the extended filament occurs only when the target nucleic acid sequence is present, and the PTO is cleaved. Therefore, the detectable signal is indicative of a presence of the target nucleic acid sequence and nucleic acid sequence. In this regard, if desired, the present invention can be carried out in a real-time manner.
[0129] [000129] To directly associate the hybridization of the OS with signals, the present invention uses at least one tag linked to the OS.
[0130] [000130] According to one embodiment, the detectable signal indicative of a presence of the target nucleic acid sequence is provided by (i) the tag attached to the SO, (ii) a combination of the tag attached to the SO, and a tag attached to the fragment from the PTO, (iii) a combination of the tag attached to the SO, and a tag to be incorporated into the extended filament during the extension reaction of step (d), or (iv) a combination of the tag attached to the SO, and an intercalating dye.
[0131] [000131] The labeling systems useful in this invention will be described in detail as follows:
[0132] [000132] Single tag connected to the OS.
[0133] [000133] The present invention can provide signal for formation of the extended strand that indicates a presence of the target nucleic acid sequence using a unique tag (see Fig. 3).
[0134] [000134] According to one embodiment, the SO is labeled with a single label, and the hybridization between the SO and the extended filament in step (e) induces change in the signal from the single label to provide the detectable signal.
[0135] [000135] The single tag used here must be able to provide a different signal depending on its presence in a double filament or single filament. The single label includes a fluorescent label, a luminescent label, a chemiluminescent label, an electrochemical label, and a metal label.
[0136] [000136] Preferably, the single tag includes a fluorescent tag that provides signals of different intensity depending on whether it is attached to a double-stranded or single-stranded nucleic acid.
[0137] [000137] Fig. 3 illustrates a preferred embodiment of the present invention using a single label. As shown in Fig. 3, the single fluorescent label attached to the hybridized OS with the extended filament exhibits more intense fluorescence than that attached to the unhybridized OS.
[0138] [000138] Changes (increase or decrease) in the fluorescent intensity of single fluorescent tags are measured to detect a presence of the target nucleic acid sequence.
[0139] [000139] Preferred types and binding sites of the unique fluorescent labels used in this invention are described in United States Patent Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety. Preferably, the single fluorescent label includes JOE, FAM, TAMRA, ROX and fluorescein-based label. The labeled nucleotide residue is preferably positioned at the inner nucleotide residue within the oligonucleotide rather than at the 5 'end or at the 3' end.
[0140] [000140] According to one embodiment, the unique tag on the SO is located at 1-15 nucleotide, 1-10 nucleotide or 1-5 nucleotide, apart from its 5 'end, or its 3' end. Most preferably, the single tag is located in the middle portion of the SO.
[0141] [000141] The single fluorescent tag useful in the present invention can be described with reference to the descriptions for reporter molecules and suppressor molecules, as indicated below. OS-linked intra-filament interactive double tag
[0142] [000142] The interactive tag system is a signal generation system in which energy is passed non-radioactively between a donor molecule and an acceptor molecule. As a representative of the interactive label system, the FRET (fluorescence resonance energy transfer) label system includes a fluorescent reporter molecule (donor molecule) and a suppressor molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent. In another form of interactive label systems, the energy donor is non-fluorescent, for example, a chromophore, and the energy acceptor is fluorescent. In yet another form of interactive label systems, the energy donor is luminescent, for example, bioluminescent, chemiluminescent, electrochemiluminescent, and the acceptor is fluorescent. The donor molecule and the acceptor molecule can be described as a reporter molecule and a suppressor molecule in the present invention, respectively.
[0143] [000143] Preferably, the signal indicative of the formation of the extended filament (i.e., the presence of the target nucleic acid sequence) is generated by the interactive tag systems, more preferably the FRET tag system (i.e., double tag system) interactive).
[0144] [000144] According to one embodiment, the SO is labeled with an interactive double tag comprising a reporter molecule and the suppressor molecule, and the hybridization between the SO and the extended filament in step (e), induces a change in the signal from the interactive double label to provide the detectable signal. Prior to hybridization of the SO, the reporter molecule and the suppressor molecule in the SO are conformationally adjacent to each other to allow the suppressor molecule to provide for the extinction of the signal from the reporter molecule. After hybridization, the reporter molecule and the suppressor molecule in the SO are conformationally separated to allow the suppressor molecule not to provide extinction of the signal from the reporter molecule, causing changes in the signals from the interactive double tag.
[0145] [000145] Fig. 2 represents a preferred embodiment of the present invention using an interactive double tag. The fragment released from the PTO hybridized to the target nucleic acid sequence is hybridized to the capture portion of the CTO, and extended to form the extended strand. After hybridization of the extended filament with the SO, the reporter molecule and the suppressor molecule in the SO are conformationally separated to allow the suppressor molecule not to provide extinction of the signal from the reporter molecule, giving rise to changes in the signals from the interactive double tag. (for example, increase in the signal from the reporter molecules). In contrast, where the target nucleic acid sequence is not present, cleavage of the PTO does not occur. The PTO is undigested and not extended while it is hybridized to the capture portion of the CTO. The reporter molecule and the suppressor molecule in the SO, not involved in hybridization, are conformationally adjacent to each other to allow the suppressor molecule to provide signal extinction from the reporter molecule.
[0146] [000146] The expression used here "the reporter molecule and the suppressor molecule are conformationally adjacent" means that the reporter molecule and the suppressor molecule are three-dimensionally adjacent to each other by a conformational structure of the fragment or SO, such as random turn and clip structure of hair.
[0147] [000147] The expression used here "the reporter molecule and the suppressor molecule are conformationally separated" means that the reporter molecule and the suppressor molecule are three-dimensionally separated by changing a conformational structure of the SO after the formation of a double filament by hybridization with the extended filament.
[0148] [000148] According to one embodiment, the reporter molecule and the suppressor molecule are positioned at the 5 'end (or 3' end), and the 3 'end (or 5' end) of the SO. According to one embodiment, one of the reporter molecule and the suppressor molecule in the SO is located at its 5 'end, or in the 1-5 nucleotides apart from its 5' end, and the other is located to provide and not provide extinction of the signal from the reporter molecule, depending on the conformation of the SO.
[0149] [000149] According to the modality, one of the reporter molecule and the suppressor molecule in the SO is located at its 3 'end, or in 1-5 nucleotides apart from its 3' end, and the other is located to provide and not to provide extinction of the signal from the reporter molecule, depending on the conformation of the SO.
[0150] [000150] According to one embodiment, the reporter molecule and the suppressor molecule are positioned at no more than 80 nucleotides, more preferably, no more than 60 nucleotides, even more preferably, no more than 30 nucleotides, even more preferably, no more than 25 nucleotides, apart from each other. According to one embodiment, the reporter molecule and the suppressor molecule are separated by at least 4 nucleotides, more preferably, at least 6 nucleotides, even more preferably, at least 10 nucleotides, even more preferably, at least 15 nucleotides.
[0151] [000151] The reporter molecule and the suppressor molecule useful in the present invention can include any molecules known in the art. Examples of these are: Cy2 ™ (506), YO-PRO ™ -1 (509), YOYO ™ -l (509), Calcein (517), FUC (518), FluorX ™ (519), Alexa ™ (520), Rhodamine 110 (520), Oregon Green ™ 500 (522), Oregon Green ™ 488 (524), RiboGreen ™ (525), Rhodamine Green ™ (527), Rhodamine 123 (529), Magnesium Green ™ (531), Calcium Green ™ (533), TO-PRO ™ -l (533), TOTOl (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3 ™ (570), Alexa ™ 546 (570), TRITC (572), Magnesium Orange ™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ™ (576) , Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ™ (590), Cy3.5 ™ (596), ROX (608), Calcium Crimson ™ (615), Alexa ™ 594 (615 ), Texas Red (615), Nile Red (628), Y0-PR0 ™ -3 (631), Y0Y0 ™ -3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO ™ -3 (660), TOT03 (660), DiD DilC (5) (665), Cy5 ™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Oran ge 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 ( 566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The numeric in parentheses is a maximum emission wavelength in the nanometer. Preferably, the reporter molecule and the suppressor molecule include JOE, FAM, TAMRA, ROX and fluorescein-based tag.
[0152] [000152] Suitable pairs of indicator-suppressors are described in a variety of publications as follows: Pesce et al., Editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996) United States Patents Nos. 3,996,345 and 4,351,760.
[0153] [000153] It should be noted that a non-fluorescent black suppressor molecule (or dark suppressor molecule), capable of extinguishing fluorescence over a wide range of wavelengths or a specific wavelength, can be used in the present invention. Examples of these are BHQ and DABCYL.
[0154] [000154] In the FRET tag adopted by the SO, the indicator involves a FRET donor, and the suppressor involves the other FRET co-participant (acceptor). For example, a fluorescein dye is used as the indicator, and a rhodamine dye as the suppressor. (iii) Interlining interactive double label.
[0155] [000155] In the modality using the interactive double tag interlining, the extended filament has one of an interactive double tag comprising a reporter molecule and a suppressor molecule, and the SO has the other of the interactive double tag.
[0156] [000156] The modality using the interactive double tag interlining can be conducted according to the following three modes:
[0157] [000157] According to the first mode, the SO comprises a tag between a reporter molecule and a suppressor molecule of an interactive double tag, the fragment from the PTO comprises the other tag between the reporter molecule and the suppressor molecule; the extended filament comprises the tag originating from the fragment from the PTO, and in which the hybridization between the SO and the extended filament induces change in the signal from the interactive double tag, to provide the detectable signal (see Fig. 5) .
[0158] [000158] An SO-linked tag can be either a reporter molecule or a suppressor molecule, and a tag for the fragment can be either a suppressor molecule or a reporter molecule.
[0159] [000159] The labeling site in the PTO is determined by considering its cleavage site, so that the PTO fragment can have the label.
[0160] [000160] The tag can be attached to any location (for example, the PTO tagging portion) on the PTO fragment, considering that it interacts with the tag to the SO after hybridization with the SO, to induce change in the signals. The tag can be attached to any location (e.g., the 5 'end of the SO) on the SO, considering that it interacts with the tag on the PTO fragment after hybridization with the PTO fragment, to induce change in the signals.
[0161] [000161] According to the second mode, the SO comprises a tag between a reporter molecule and a suppressor molecule of an interactive double tag, and the modeling portion of the CTO comprises a nucleotide having a first unnatural base; wherein the extension reaction in step (d) is carried out in the presence of a nucleotide having both a second unnatural base with a specific binding affinity for the first unnatural base, and the other between the reporter molecule and the suppressor molecule, thereby incorporating the label into the extended filament; in which hybridization between the SO and the extended filament induces a change in the signal from the interactive double tag to provide the detectable signal (see Fig. 6).
[0162] [000162] The term used here "unnatural base" refers to derivatives of natural bases, such as adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), which are capable to form hydrogen bond base pairs. The term used herein "unnatural base" includes bases having different base pairing patterns than natural bases as parent compounds, as described, for example, in United States Patent Nos. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. The base pairing between unnatural bases involves two or three hydrogen bonds as natural bases. The base pairing between unnatural bases is also formed in a specific way.
[0163] [000163] Specific examples of unnatural bases include the following bases in base pair combinations: iso-C / iso-G, iso-dC / iso-dG, K / X, H / J, and M / N (see Patent United States No. 7,422,850).
[0164] [000164] The tag incorporated during the extension is preferably linked to a nucleotide, more preferably, to a nucleoside triphosphate. Preferably, the tag is attached to a nucleoside triphosphate base.
[0165] [000165] The exemplified embodiment is described with reference to Fig. 6. The fragment is hybridized to the CTO with a nucleotide having an unnatural base (for example, iso-dC), with a specific binding affinity to an unnatural base (e.g., iso-dG). The extension is carried out in the presence of a nucleotide having the iso-dG labeled with a suppressor to form the extended filament. In the extension reaction, the nucleotide having iso-dG with a suppressor is incorporated into a site opposed to the nucleotide having iso-dC. Then the hybridization of the extended filament containing the suppressor-iso-dG with the SO labeled with an indicator, the suppressor in the extended filament extinguishes the signal from the indicator in the SO, to induce changes in the signal, providing the detectable signal.
[0166] [000166] One of the interactive double tags is attached to the SO, and the other is incorporated into the extended filament of a reaction solution during the extension reaction.
[0167] [000167] An SO-linked tag can be either a reporter molecule or a suppressor molecule, and a tag embedded in the extended filament can be either a suppressor molecule or a reporter molecule.
[0168] [000168] The tag incorporated in the extended filament can be connected to any location in the extended filament (for example, the 3 'end of the extended filament), considering that it interacts with the tag to the SO after hybridization with the SO, for induce change in signals. [0161] The tag can be attached to any location (for example, the 5 'end of the SO) on the SO, considering that it interacts with the tag embedded in the extended filament after hybridization with the extended filament, to induce change in signals.
[0169] [000169] According to the third mode, the SO comprises a tag between a reporter molecule and a suppressor molecule of an interactive double tag, and the extension reaction in step (d) is carried out in the presence of a nucleotide having the other between the reporter molecule and the suppressor molecule, thereby incorporating the tag in the extended filament; in which the hybridization between the SO and the extended filament induces a change in the signal from the interactive double tag, to provide the detectable signal (see Fig. 7).
[0170] [000170] An SO-linked label can be either a reporter molecule or a suppressor molecule (preferably a reporter molecule), and a label incorporated in the extended filament can be either a suppressor molecule or a reporter molecule (preferably suppressor molecule) . (iv) Interactive double tag using two OSs
[0171] [000171] In the interactive double tag mode using two SOs, the method of the present invention uses an additional OS comprising a sequence complementary to the extended filament, the two SOs are hybridized to the extended filament in an adjacent manner, the two SOs each comprise a tag between a reporter molecule and an interactive double tag suppressor molecule; and hybridization between the two SOs and the extended filament induces a change in the signal from the interactive double tag, to provide the detectable signal (see Fig. 4).
[0172] [000172] Preferably, at least one of the two SOs comprises a hybridized portion for a newly extended sequence in the extension reaction.
[0173] [000173] The principle underlying the performance of the interactive double tag modality using two SOs are as follows: The fragment released from the PTO hybridized to the target nucleic acid sequence is hybridized to the capture portion of the CTO, and extended to form the extended filament. Then, the two SOs are hybridized to the extended filament. In hybridization, since the two SOs are adjacent hybridized to the extended filament, the reporter molecule and the suppressor molecule in the two SOs are adjacent to each other, to allow the suppressor molecule to provide extinction of the signal from the reporter molecule, resulting in the change in the signals from the interactive double tag (for example, increase in the signal from the reporter molecules). In contrast, where the target nucleic acid sequence is not present, cleavage of the PTO does not occur. The undigested PTO is not extended, whereas it is hybridized to the capture portion of the CTO. The reporter molecule and the suppressor molecule in the two SOs not involved in hybridization are separated from each other, to generate signal from the reporter molecule.
[0174] [000174] According to one modality, the two SOs can be hybridized with any locations of the extended filament, considering that their hybridization with the extended filament allows the suppressor molecule to provide extinction of the signal from the reporter molecule.
[0175] [000175] Preferably, the two SOs are positioned in an immediately adjacent manner, or 1-5 nucleotides apart from each other.
[0176] [000176] According to a modality, where the two SOs can be hybridized adjacent to the extended filament, the reporter molecule and the suppressor molecule can be linked to any location of the two SOs, considering that the suppressor molecule extinguishes the signal at from the reporter molecule. For example, the reporter molecule, or the suppressor molecule, is attached to the 5 'end of an SO, or 1-5 nucleotides to the part of its 5' end, and the suppressor molecule, or the reporter molecule, to the 3 'from the other SO, or 1-5 nucleotides apart from its 3' end. (v) FRET label using intercalating dyes
[0177] [000177] In accordance with the present invention, a FRET (fluorescence resonance energy transfer) signaling becomes practical using intercalating dyes.
[0178] [000178] According to a modality, the SO comprises a FRET acceptor, and the hybridization in step (e) is carried out in the presence of an intercalating dye; in which the hybridization between the SO and the extended filament induces a change in the signal from the SO acceptor, to provide the detectable signal (see Fig. 8).
[0179] [000179] Exemplary intercalating dyes useful in this invention include SYBR ™ Green I, PO-PRO ™ -l, BO-PRO ™ -l, SYTO ™ 43, SYTO ™ 44, SYTO ™ 45, SYTOX ™ Blue, POPO ™ -l, POPO ™ -3, BOBO ™ -l, BOBO ™ -3, L0-PR0 ™ -1, JO-PRO ™ -l, YO-PRO ™ l, TO-PRO ™ l, SYT0 ™ 11, SYTO ™ 13, SYTO ™ 15, SYTO ™ 16, SYTO ™ 20, SYTO ™ 23, TOTO ™ -3, YOYO ™ 3, GelStar ™ and orange thiazole. The intercalating dyes are specifically intercalated in the double-stranded nucleic acid molecules to generate signals.
[0180] [000180] The underlying principle of FRET tag modality performance using intercalating dyes are as follows: The fragment released from the PTO hybridized to the target nucleic acid sequence is hybridized to the capture portion of the CTO, and extended to form the extended filament. Then, the acceptor-labeled SO is hybridized to the extended strand to form a double-stranded nucleic acid molecule, and then the intercalating dyes are attached to the double-stranded nucleic acid molecule. Energy transfer occurs from intercalating dyes, which serve as a donor molecule to the acceptor by lighting to excite the donor, inducing change in the signal from the acceptor to provide the detectable signal. In contrast, the FRET phenomenon does not occur in the absence of the target nucleic acid sequence, resulting in no change in signal.
[0181] [000181] According to one embodiment, the acceptor bound to the OS includes several unique fluorescent tags described above, but not limited to these.
[0182] [000182] A tag can be connected to the OS, or to the PTO, by conventional methods. Preferably, it is attached to the SO or PTO through a spacer containing at least three carbon atoms (for example, 3-carbon spacer, 6-carbon spacer or 12-carbon spacer).
[0183] [000183] The SO useful in the present invention includes any probes capable of providing hybridization-dependent signals, for example, Molecular beacon ™ (United States Patent No. 5,925,517), Hybeacons ™ (D. 3. French, et al. , Molecular and Cellular Probes (2001) 13, 363-374 and United States Patent No. 7,348,141), Dual-labeled, self-quenched probe (United States Patent No. 5,876,930), LUX ™ (IA Nazarenko, et al. Nucleic Acids Res 2002, 30: 2089-2095, and United States Patent No. 7,537,886) and Hybridization probe (Bernard PS, et al., Clin Chem 2000, 46, 147-148 and Deepti Parashar et al., Indian J Med Res 124, review article October 2006 385-398). Step (f): Target signal detection
[0184] [000184] Finally, the detectable signal provided in step (e) is detected, where the detection of the signal indicates the presence of the extended strand, and the presence of the target nucleic acid sequence.
[0185] [000185] As discussed above, the hybridization event of the SO is synchronized with the labeling event of the resulting hybridization to provide signals indicative of the target nucleic acid sequence. In this regard, the present invention can be carried out in a real-time manner using tags that provide detectable signals in real-time mode.
[0186] [000186] Alternatively, detection of the target signal can be performed by a fusion analysis because the tags used in the present invention are capable of providing detectable signals during fusion of the resulting hybridization, or fusion and hybridization of the resulting hybridization.
[0187] [000187] The term used here "fusion analysis" means a method in which a signal indicative of the presence of the extended duplex is obtained by fusing the extended duplex, including a method for measuring signals at two different temperatures, curve analysis of melting, standard melting analysis and peak melting analysis. Preferably, the melt analysis is a melt curve analysis.
[0188] [000188] For example, when the duplex between the SO and the extended filament is fused, the reporter molecule and the suppressor molecule in the single-stranded OS are conformationally adjacent to each other to allow the suppressor molecule to provide signal extinction from the molecule reporter, such that change in signals is induced to give the detectable signal. In addition, where the SO and the extended filament are re-hybridized to form a duplex, the reporter molecule and the suppressor molecule in the SO are conformationally separated to allow the suppressor molecule not to provide extinction of the signal from the reporter molecule, such that changes in signals is induced to give the detectable signal (see Fig. 2).
[0189] [000189] According to one embodiment, the presence of the extended filament of the PTO fragment is detected by a melt curve analysis using Tm values of the duplex between the SO and the extended filament.
[0190] [000190] Where the Tm values of the duplex between the SO and the extended filament are used for analysis, it is preferable to use labels (for example, fluorescent labels) that allow homogeneous testing with no separation of the resulting hybridization between the SO and the extended filament.
[0191] [000191] According to one embodiment, the resulting hybridization between the SO and the extended filament has Tm values that are adjustable by sequence and / or length of the PTO fragment, sequence and / or length of the CTO, sequence and / or length of the SO, and its combination.
[0192] [000192] For example, the Tm values of the resulting hybridization can be adjusted by adjusting the mismatch extension of the SO sequence. In addition, by adjusting the lengths of the SO, the Tm values of the resulting hybridization can also be adjusted.
[0193] [000193] Preferably, the present method further comprises the step of providing a detectable signal between steps (e) and (f) by fusing the hybridization resulting from step (e), or by fusing and hybridizing the hybridization resulting from step (e) ); in which step (f) is carried out by detecting the signal to determine the presence of the extended filament.
[0194] [000194] Alternatively, the present method further comprises the step of providing and detecting a detectable signal after step (f) by fusing the hybridization resulting from step (e), or by fusing and hybridizing the hybridization resulting from step (e), whereby the presence of the extended filament is determined once again.
[0195] [000195] According to one embodiment, the presence of the extended filament of the PTO fragment is detected by a hybridization curve analysis.
[0196] [000196] The term used here "Tm" refers to a melting temperature at which half of a population of double-stranded nucleic acid molecules is dissociated to single-stranded molecules. The Tm value is determined by the length and the G / C content of the hybridized nucleotides. The Tm value can be calculated by conventional methods, such as the Wallace rule (RB Wallace, et al., Nucleic Acids Research, 6: 3543-3547 (1979)) and the nearest neighbor method (SantaLucia J. Jr., et al. , Biochemistry, 35: 3555-3562 (1996)); Sugimoto N., et al., Nucleic Acids Res., 24: 4501-4505 (1996)).
[0197] [000197] According to one modality, the Tm value refers to real Tm values under actual reaction conditions.
[0198] [000198] The fusion curve, or hybridization curve, can be obtained by conventional technologies, for example, as described in United States Patent Nos. 6,174,670 and 5,789,167, Drobyshev et al, Gene 188: 45 (1997); Kochinsky and Mirzabekov Human Mutation 19: 343 (2002); Livehits et al J. Biomol. Structure Dynam. 11: 783 (1994); and Howell et al Nature Biotechnology 17:87 (1999). For example, a fusion curve, or hybridization curve, can consist of a graph or display of the variation of the output signal with the hybridization stringency parameter. The output signal can be plotted directly against the hybridization parameter. Typically, a fusion curve or hybridization curve will have the output signal, for example, fluorescence, which indicates the degree of duplex structure (that is, the extent of hybridization), plotted on the Y axis, and the hybridization parameter on the X axis.
[0199] [000199] A graph of the first derivative of fluorescence vs. temperature, that is, a graph of the rate of change in fluorescence vs. temperature (dF / dT vs. T) or (-dF / dT vs. T), provides peak melting.
[0200] [000200] The formation of the extended filament can be detected by the size of the extended filament. The hybridized SO with the extended filament provides a detectable signal for detecting the extended filament by the length of the extended filament. For example, where the formation of the extended filament is detected by various electrophoresis methods, such as gel electrophoresis and polyacrylamide gel electrophoresis, the SO hybridized to the extended filament provides a signal in a gel matrix indicating the presence of the extended filament . Preferably, the OS with a single fluorescent tag is used.
[0201] [000201] PTO, CTO and SO can be comprised of naturally occurring dNMPs. Alternatively, PTO, CTO and SO can be comprised of modified nucleotide or unnatural nucleotide, such as PNA (nucleic acid peptide, see PCT Publication No. WO 92/20702) and LNA (blocked nucleic acid, see PCT Publications Nos. WO 98/22489, WO 98/39352 and WO 99/14226). PTO, CTO and SO can comprise universal bases, such as deoxyinosine, inosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrole and 5-nitroindole. The term "universal base" refers to one capable of forming base pairs with each of the natural DNA / RNA bases with little discrimination between them.
[0202] [000202] As described above, the PTO can be cleaved at a site located in a 3 'direction to the 3' end part of the 5 'labeling portion of the PTO. The cleavage site can be located at the 5 'terminal part of the 3' targeting portion of the PTO. Where the PTO fragment comprises the 5 'terminal part of the 3' targeting portion of the PTO, a CTO site hybridized to the 5 'terminal part of the 3' targeting portion may comprise a universal base, degenerate sequence, or their combination. For example, if the PTO is cleaved at a site located a nucleotide in a 3 'direction apart from the 3' end of the 5 'labeling portion of the PTO, it is advantageous that the 5' terminal part of the portion of capture of the CTO comprises a universal base for hybridization with the nucleotide. If the PTO is cleaved at a site located two nucleotides in a 3 'direction apart from the 3' end of the 5 'labeling portion of the PTO, it is advantageous that the 5' end of the CTO capture portion comprises a degenerate sequence and its 3'-direction adjacent to the nucleotide comprises a universal base. As such, where cleavage of the PTO occurs at various locations on the terminal-5 'part of the targeting portion-3', the use of universal bases and degenerate sequences in the CTO is useful. In addition, where PTOs having the same 5 'labeling portion are used for classification of multiple target nucleic acid sequences under induction of upstream primer extension dependent cleavage, PTO fragments having different 5' terminal parts of the targeting-3 'portion can be generated. In such cases, universal bases and degenerate sequences are usefully employed in the CTO. Strategies using universal bases and degenerate sequences in the CTO ensure that one type or minimal types of the CTO are used for classification of multiple target nucleic acid sequences.
[0203] [000203] According to one embodiment, the present method additionally comprises the denaturation step between steps (d) and (e). The extended duplex formed in step (d) is denatured to a single filament form, and then hybridized to the SO.
[0204] [000204] According to a modality, the method additionally comprises repeating all or some of the steps (a) - (f) with denaturation between repetition cycles. For example, the method further comprises repeating steps (a) - (b), (a) - (d) or (a) - (f) with denaturation between repetition cycles. This repetition allows to amplify the target nucleic acid sequence and / or the target signal.
[0205] [000205] According to one embodiment, the present invention further comprises repeating steps (a) - (e) with denaturation between repetition cycles, and fusing the hybridization resulting from step (e), or fusing and hybridizing the hybridization resulting from step (e), to provide a detectable signal; in which step (f) is carried out by detecting the signal to determine the presence of the extended filament.
[0206] [000206] Denaturation can be carried out by conventional technologies, including, but not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods (eg helicase action), and binding proteins. For example, melting can be achieved by heating to a temperature ranging from 80 ° C to 105 ° C. General methods for carrying out this treatment are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
[0207] [000207] According to one embodiment, the present invention can be carried out by a series of fusion analysis to qualitatively or quantitatively detect the target nucleic acid sequence.
[0208] [000208] More preferably, the present invention comprises (i) repeating steps (a) - (d) with denaturation between repetition cycles to form the extended filament, (ii) performing a hybridization fusion analysis resulting from the SO and the extended filament, and (iii) repeat steps (i) and (ii) at least twice. In such an approach, the fusion analysis is repeatedly performed at least twice in a given interval.
[0209] [000209] According to a modality, the number of repetition of steps (a) - (d) can be optionally controlled. In carrying out a series of fusion analyzes, the number of repetition of steps (a) - (d) for a course of a fusion analysis can be the same as, or different from that of repetition of steps (a) - (d ) for another course of a fusion analysis.
[0210] [000210] One skilled in the art would understand that the repetition of steps (a) - (d) is an illustrative example for the formation of the extended filament. For example, the present invention can be carried out by repeating steps (a) - (b), and performing steps (c) and (d), to form the extended filament, followed by performing a melt analysis.
[0211] [000211] According to one embodiment, steps (a) - (f) are carried out in a reaction vessel, or in separate reaction vessels. For example, steps (a) - (b), (c) - (d) or (e) - (f), can be performed in separate reaction vessels.
[0212] [000212] According to a modality, steps (a) - (b) and (c) - (f) can be simultaneously or separately even in a reaction vessel depending on the reaction conditions (particularly, temperature).
[0213] [000213] According to a modality, steps (a) - (b) are repeated with denaturation.
[0214] [000214] Where the upstream primer is used as the upstream oligonucleotide in the repeating process, the present method is preferably carried out in the presence of a downstream primer, preferably by PCR.
[0215] [000215] According to one embodiment, at least two fusion analyzes in the present invention allow the target nucleic acid sequence to be quantitatively detected.
[0216] [000216] The area and height of a fusion peak obtained by a fusion analysis is dependent on the amount of the extended duplex, providing information on the initial amount of the target nucleic acid sequence.
[0217] [000217] According to one embodiment, the present invention comprises (i) increasing the number of the extended filament by repeating steps (a) - (d) with denaturation between repetition cycles, (ii) carrying out a fusion analysis for the resulting hybridization between the SO and the extended filament, and (iii) repeating steps (i) and (ii) at least twice. The amount of the target nucleic acid sequence can be measured by determining a cycle number of the fusion analyzes, in which a predetermined threshold value over the areas and / or the peak fusion heights obtained is achieved.
[0218] [000218] Alternatively, quantification of the target nucleic acid sequence can be performed by plotting the fusion analysis information (e.g., peak area or peak) against the repetition cycle number to increase the amount of the extended filament.
[0219] [000219] The present invention does not require that target nucleic acid sequences be detected and / or amplified having any particular sequence or length, including any DNA (gDNA and cDNA) and RNA molecules.
[0220] [000220] Where an mRNA is employed as a starting material, a reverse transcription step is required prior to performing the annealing step, details of which are found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, K. F. et al., Nuclei Acids Res. 16: 10366 (1988). For reverse transcription, a random hexamer or a mRNA hybridizable oligonucleotide dT primer can be used.
[0221] [000221] Target nucleic acid sequences that can be detected and / or amplified include any naturally occurring, eukaryotic prokaryotic (e.g., protozoa and parasites, fungi, yeasts, higher plants, lower and higher animals, including mammals and humans ), or viral (for example, Herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.) or viroid nucleic acid.
[0222] [000222] The target nucleic acid sequence to be detected by the present invention includes a wide variety of nucleic acid sequences, for example, sequences in a genome, artificially isolated or fragmented sequences, and synthesized sequences (for example, cDNA sequences and barcode strings). For example, the target nucleic acid sequence includes nucleic acid marker sequences for Immuno-PCR (IPCR). IPCR employs conjugates between nucleic acid marker sequences and antibodies together with PCR, which is widely applied for detecting various types of tags including proteins (see Sano et al., Science 258 pp: 120-122 (1992), United States Patent United No. 5,665,539, Niemeyer et al., Trends in Biotechnology 23 pp: 208-216 (2005), United States Patent Publication No. 2005/0239108, and Ye et al., Journal of Environmental Science 22 pp: 796-800 (2010)).
[0223] [000223] The present invention is also useful in detecting a variation of nucleotides. Preferably, the target nucleic acid sequence comprises a nucleotide variation. The term "nucleotide variation" used herein refers to any single or multiple nucleotide substitutions, deletions or insertions in a DNA sequence at a particular location between contiguous DNA segments that are otherwise similar in sequence. Such contiguous DNA segments include a gene or any other portion of a chromosome. These nucleotide variations can be variations of polymorphic or mutant alleles. For example, the nucleotide variation detected in the present invention includes SNP (single nucleotide polymorphism), mutation, deletion, insertion, substitution and translocation. The exemplified nucleotide variation includes numerous variations in a human genome gene (for example, variations in MTHFR (methylene tetrahydrofolate reductase)), variations involved in drug resistance to pathogens, and variations that cause tumorigenesis. The term nucleotide variation used herein includes any variation to a particular location on a DNA molecule. In other words, the term nucleotide variation includes a wild type and any mutant type at a particular location on a DNA molecule.
[0224] [000224] In the present invention for detecting a nucleotide variation in a target nucleic acid sequence, where primers or probes used have a sequence complementary to the nucleotide variation in the target nucleic acid sequence, the target nucleic acid sequence containing the variation nucleotide is described here as a mismatched model. When the primers or probes used have a sequence not complementary to the nucleotide variation in the target nucleic acid sequence, the target nucleic acid sequence containing the nucleotide variation is described herein as a mismatched model.
[0225] [000225] For detection of nucleotide variation, the 3 'end of the upstream primer can be designed to be opposite a site of a nucleotide variation in a target nucleic acid sequence. According to a preferred embodiment, the 3 'end of the upstream primer has a sequence complementary to the nucleotide variation in a target nucleic acid sequence. The 3 'end of the upstream primer having a sequence complementary to the nucleotide variation in the target nucleic acid sequence is annealed to the paired model and extended to induce PTO cleavage. The resulting PTO fragment is hybridized to the CTO, extended and hybridized to the SO, to provide the target signal. In contrast, when the 3 'end of the upstream primer is mismatched to a variation of nucleotide in a mismatched model, it is not extended under annealing conditions of the 3' end of the primers that are essential for extension even when the primer upstream it is hybridized with the mismatched model, thus resulting in no generation of the target signal.
[0226] [000226] Alternatively, it is possible to use PTO cleavage, depending on the hybridization of PTO having a sequence complementary to a nucleotide variation in a target nucleic acid sequence. For example, under controlled conditions, a PTO having a sequence complementary to the nucleotide variation in the target nucleic acid sequence is hybridized to the paired model and then cleaved. The resulting PTO fragment is hybridized to the CTO, extended and hybridized to the SO, to provide the target signal. While, under controlled conditions, the PTO is not hybridized with a spiked model having a non-complementary sequence in the nucleotide variation position, and not cleaved. Preferably, in this case, the sequence complementary to the nucleotide variation in the PTO is positioned in its middle part of the 3 'targeting portion of the PTO.
[0227] [000227] Alternatively, it is preferable that the 5 'terminal part of the 3' targeting portion of the PTO is positioned at a nucleotide variation in a target nucleic acid sequence for the detection of the nucleotide and 5-terminal variation 'of the targeting-3' portion of the PTO, have a sequence complementary to the nucleotide variation in a target nucleic acid sequence (see Fig. 9).
[0228] [000228] When a probe, having its nucleotide variation discrimination portion in its 5 'end portion, is hybridized to a mismatched model, its 5' end portion may form a single filament under a certain condition. The probe can correspond to a PTO. The signal can be generated by the present method. This approach can be useful in detecting a target nucleic acid sequence having a nucleotide variation not complementary to the nucleotide variation discrimination site of the probes.
[0229] [000229] According to one embodiment, the target nucleic acid sequence used in the present invention is a pre-amplified nucleic acid sequence. The use of the pre-amplified nucleic acid sequence allows to significantly increase the sensitivity and specificity of the target detection of the present invention.
[0230] [000230] According to one embodiment, the method is carried out in the presence of a downstream initiator.
[0231] [000231] The advantages of the present invention can be enhanced in the simultaneous (multiplex) detection of at least two target nucleic acid sequences.
[0232] [000232] According to one embodiment, the method is performed to detect at least two types (more preferably, at least three types, even more preferably, at least five types) of target nucleic acid sequences.
[0233] [000233] According to one embodiment, the method is performed to detect at least two types (more preferably, at least three types, even more preferably, at least five types) of target nucleic acid sequences; in which the upstream oligonucleotide comprises at least two types (more preferably, at least three types, even more preferably, at least five types) of the oligonucleotides, the PTO comprises at least two types (more preferably, at least three types, even more preferably, at least five types) of the PTOs, the CTO comprises at least two types (preferably, at least three types, more preferably, at least five types) of the CTO, and the SO comprises at least two types (preferably, at least three types) types, more preferably, at least five types) of the OS; in which when at least two types of the target nucleic acid sequences are present, the method provides at least two types of the target signals (the detectable signals) corresponding to at least two types of the target nucleic acid sequences.
[0234] [000234] The 5 'labeling portions of the at least two PTOs can have an identical sequence to each other. For example, where the present invention is performed for classification of target nucleic acid sequences, the 5 'labeling portions of the PTOs may have the identical sequence.
[0235] [000235] In addition, a single type of CTO can be used to detect a plurality of target nucleic acid sequences. For example, where PTOs having an identical sequence in their 5 'labeling portions are employed for classification of target nucleic acid sequences, a unique type of CTO can be used.
[0236] [000236] Where the present invention is performed to simultaneously detect at least two types of the target nucleic acid sequences by melting curve analysis, and the resulting hybridization in step (e) corresponding to at least two types of the target nucleic acid sequences have different Tm values, it is possible to detect at least two types of the target nucleic acid sequences even using a single type of a tag (for example, FAM).
[0237] [000237] According to one embodiment, the Tm value of the SO / extended filament hybrid can be adjusted by the sequence and / or length of the SO, the sequence and / or length of a portion of the extended filament to be hybridized with the SO, or combination of these. Particularly, where the extended filaments formed in the present multiplex detection are hybridized to a unique type of the OS, the Tm values of the hybrids between the extended filaments and the SOs are different from each other if the portions of the extended filaments to be hybridized to the SOs are designed to have different sequences from each other. Therefore, multiplex detection can become practical even when using a single type OS.
[0238] [000238] The present invention can be carried out in a solid phase, such as a microarray.
[0239] [000239] According to one embodiment, the present invention is carried out in the solid phase, and the CTO or SO is immobilized through its 5 'end or 3' end on a solid substrate.
[0240] [000240] For the solid phase reaction, the CTO or SO is immobilized directly or indirectly (preferably, indirectly) through its 5 'end or 3' end (preferably, the 3 'end) on the substrate surface solid. In addition, the CTO or SO can be immobilized on the surface of the solid substrate in a covalent or non-covalent manner. Where immobilized CTOs or SOs are indirectly on the surface of the solid substrate, suitable binders are used. The binders useful in this invention can include any binders used for probe immobilization on the surface of the solid substrate. For example, alkyl or aryl compounds with amine functionality, or alkyl or aryl compounds with thiol functionality, serve as binders for immobilizing CTO or SO. In addition, poly (T) or poly (A) tail can serve as binders.
[0241] [000241] According to one embodiment, the solid substrate used in the present invention is a microarray. The microarray to provide a reaction environment in this invention can include anyone known to one skilled in the art. All the processes of the present invention, that is, hybridization to the target nucleic acid sequences, cleavage, extension, fusion and fluorescence detection, are carried out in the microarray. The CTOs or SOs immobilized in the microarray serve as standard hybridizable elements. The solid substrate to produce the microarray includes, but is not limited to, metals (eg gold, gold and copper alloy, aluminum), metal oxide, glass, ceramics, quartz, silicon, semiconductor, Si / SiO2 pellet , germanium, gallium arsenide, carbon, carbon nanotube, polymers (eg polystyrene, polyethylene, polypropylene and polyacrylamide), sepharose, agarose and colloids. A plurality of TOs or SOs immobilized in this invention can be immobilized in one addressable region, or two or more addressable regions on a solid substrate that can comprise 2-1,000,000 addressable regions. Immobilized CTOs or SOs can be manufactured to produce series or series for a given application by conventional manufacturing technologies, such as photolithography, inkblasting, mechanical micro-staining, and derivatives thereof.
[0242] [000242] According to one embodiment, an OS immobilized on the surface of the solid substrate has an interactive double tag.
[0243] [000243] In the present invention, a PTO fragment is produced by cleaving the PTO hybridized to the target nucleic acid, and is annealed and extended in the CTO, resulting in the formation of an extended filament.
[0244] [000244] It is also possible to provide additional extensible fragments in the CTO for enhancing the number of strands extended by an additional 5 'nuclease cleavage reaction using an additional PTO comprising, (i) a 3' targeting portion comprising a hybridization of nucleotide sequence complementary to the extended filament, and (ii) a 5 'tagging portion comprising a nucleotide sequence not complementary to the extended filament, but complementary to the capture portion of the CTO.
[0245] [000245] Preferably, the additional PTO is located downstream of SO hybridization to the extended filament. The SO induces cleavage of the additional PTO by an enzyme having a 5 'nuclease activity. When the 3 'end of SO is extensible, the extended filament of the SOs induces cleavage of the additional PTO.
[0246] [000246] The preferable embodiment above has the characteristic that the formation of the additional fragments is dependent on the formation of an extended filament.
[0247] [000247] Alternatively, the additional fragments can be provided by the use of an additional PTO comprising (i) a 3 'targeting portion comprising a nucleotide sequence hybridization complementary to the CTO modeling portion, and (ii) a portion labeling-5 'comprising a nucleotide sequence not complementary to the modeling portion of the CTO, but complementary to the capture portion of the CTO. Preferred modality with amplification of a target nucleic acid sequence
[0248] [000248] Preferably, the present invention is carried out simultaneously with amplification of a target nucleic acid sequence using a primer pair composed of an upstream and a downstream primer, capable of synthesizing the target nucleic acid sequence.
[0249] a) hibridizar a sequência de ácido nucleico alvo com um par de iniciador compreendendo um iniciador a montante e um iniciador a jusante, e um PTO (Oligonucleotídeo de Sondagem e de Etiquetagem); no qual cada um do iniciador a montante e do iniciador a jusante compreende uma hibridização da sequência de nucleotídeo complementar às sequências de ácido nucleico alvo; o PTO compreende (i) uma porção de direcionamento-3’ compreendendo uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo, e (ii) uma porção de etiquetagem-5’ compreendendo uma sequência de nucleotídeo não complementar à sequência de ácido nucleico alvo; no qual a porção de direcionamento-3’ é hibridizada com a sequência de ácido nucleico alvo, e a porção de etiquetagem-5’ não é hibridizada com a sequência de ácido nucleico alvo; o PTO está localizado entre o iniciador a montante e o iniciador a jusante; no qual o PTO é bloqueado em sua extremidade-3’, para impedir sua extensão; b) contatar a resultante da etapa (a) a uma polimerase de ácido nucleico dependente do modelo, tendo uma atividade de 5' nuclease sob condições para extensão dos iniciadores, e para clivagem do PTO; no qual quando o PTO é hibridizado com a sequência de ácido nucleico alvo, o iniciador a montante é estendido, e o filamento estendido induz clivagem do PTO pela polimerase de ácido nucleico dependente do modelo tendo a atividade de 5' nuclease, tal que a clivagem libera um fragmento compreendendo a porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO; c) hibridizar o fragmento liberado a partir PTO com um oligonucleotídeo de captura e modelagem(CTO); no qual o CTO compreende, em uma direção 3’ a 5’ (i), uma porção de captura compreendendo uma sequência de nucleotídeo complementar à porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO, e (ii) uma porção de modelagem compreendendo uma sequência de nucleotídeo não complementar à porção de etiquetagem-5’, e a porção de direcionamento-3’ do PTO; no qual o fragmento liberado a partir do PTO é hibridizado com a porção de captura do CTO; d) realizar uma reação de extensão usando a resultante da etapa (c), e uma polimerase de ácido nucleico dependente do modelo; no qual o fragmento hibridizado com a porção de captura do CTO é estendido para formar um filamento estendido compreendendo uma sequência estendida complementar à porção de modelagem do CTO, formando, desse modo, um duplex estendido; e) hibridizar o filamento estendido com um oligonucleotídeo de sinalização (SO); no qual o SO compreende uma sequência complementar ao filamento estendido, e pelo menos uma etiqueta; o SO proporciona um sinal detectável por hibridização com o filamento estendido; e f) detectar o sinal; pelo que a detecção do sinal indica a presença do filamento estendido, e a presença da sequência de ácido nucleico alvo. [000249] In another aspect of this invention, a method for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids is provided by an CE-SH assay (PTO Cleavage and Hybridization of Dependent Signaling Oligonucleotide Extension Program), comprising: a) hybridize the target nucleic acid sequence with a primer pair comprising an upstream and a downstream primer, and a PTO (Probing and Labeling Oligonucleotide); in which each of the upstream and downstream primers each comprises a hybridization of the nucleotide sequence complementary to the target nucleic acid sequences; the PTO comprises (i) a 3 'targeting portion comprising a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5' tagging portion comprising a nucleotide sequence not complementary to the acid sequence target nucleic; in which the targeting portion-3 'is hybridized to the target nucleic acid sequence, and the labeling portion-5' is not hybridized to the target nucleic acid sequence; the PTO is located between the upstream and downstream initiators; in which the PTO is blocked at its 3 'end, to prevent its extension; b) contacting the resultant of step (a) to a model-dependent nucleic acid polymerase, having a 5 'nuclease activity under conditions for extension of the primers, and for cleavage of the PTO; in which when the PTO is hybridized to the target nucleic acid sequence, the upstream primer is extended, and the extended strand induces cleavage of the PTO by the model-dependent nucleic acid polymerase having the 5 'nuclease activity, such that the cleavage releases a fragment comprising the 5 'tagging portion, or a part of the 5' tagging portion; c) hybridize the fragment released from PTO with a capture and modeling oligonucleotide (CTO); in which the CTO comprises, in a 3 'to 5' (i) direction, a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and (ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion, and the 3' targeting portion of the PTO; in which the fragment released from the PTO is hybridized to the capture portion of the CTO; d) carrying out an extension reaction using that resulting from step (c), and a model-dependent nucleic acid polymerase; in which the fragment hybridized to the capture portion of the CTO is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; e) hybridize the extended strand with a signaling oligonucleotide (SO); in which the SO comprises a sequence complementary to the extended filament, and at least one tag; the SO provides a detectable signal by hybridization with the extended filament; and f) detecting the signal; whereby the detection of the signal indicates the presence of the extended strand, and the presence of the target nucleic acid sequence.
[0250] [000250] Since the preferred embodiment of the present invention follows the steps of the present method described above, the common descriptions between them are omitted in order to avoid undue redundancy, which leads to the complexity of this specification.
[0251] [000251] According to a modality, the method additionally comprises repeating all or some of the steps (a) - (f) with denaturation between repetition cycles. For example, the method further comprises repeating steps (a) - (b), (a) - (d) or (a) - (f), with denaturation between repetition cycles. The repetition of the reaction is carried out by amplifying the target nucleic acid sequence. Preferably, amplification is performed according to PCR (polymerase chain reaction) which is described in United States Patent Nos. 4,683,195, 4,683,202, and 4,800,159.
[0252] [000252] According to one embodiment, the method is performed to detect at least two types of target nucleic acid sequences. Target Detection Process by PCE-SH Assay Based on Upstream Oligonucleotide Independent 5 'Nuclease Activity
[0253] [000253] The present invention can be accomplished with no use of upstream oligonucleotides.
[0254] a) hibridizar a sequência de ácido nucleico alvo com um oligonucleotídeo de sondagem e alvo (PTO); no qual o PTO compreende (i) uma porção- alvo-3' compreendendo uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo, e (ii) uma porção de etiquetagem-5’ compreendendo uma sequência de nucleotídeo não complementar à sequência de ácido nucleico alvo; no qual a porção de direcionamento-3’ do PTO é hibridizada com a sequência de ácido nucleico alvo, e a porção de etiquetagem-5’ não é hibridizada com a sequência de ácido nucleico alvo; b) contatar a resultante da etapa (a) a uma enzima tendo a atividade de nuclease 5’ sob condições para clivagem do PTO; no qual o PTO é clivado pela enzima tendo a atividade de nuclease 5’, tal que a clivagem libera um fragmento compreendendo a porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO; c) hibridizar o fragmento liberado a partir do PTO com um oligonucleotídeo de captura e de modelagem (CTO); no qual o CTO compreende, em uma direção 3’ a 5’, (i) uma porção de captura compreendendo uma sequência de nucleotídeo complementar à porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO, e (ii) uma porção de modelagem compreendendo uma sequência de nucleotídeo não complementar à porção de etiquetagem-5’ e à porção de direcionamento-3’ do PTO; no qual o fragmento liberado a partir do PTO é hibridizado com a porção de captura do CTO; d) realizar uma reação de extensão usando a resultante da etapa (c), e uma polimerase de ácido nucleico dependente do modelo; no qual o fragmento hibridizado com a porção de captura do CTO é estendido para formar um filamento estendido compreendendo uma sequência estendida complementar à porção de modelagem do CTO, formando, desse modo, um duplex estendido; e) hibridizar o filamento estendido com um oligonucleotídeo de sinalização (SO); no qual o SO compreende uma sequência complementar ao filamento estendido, e pelo menos uma etiqueta; o SO proporciona um sinal detectável pela hibridização com o filamento estendido; e f) detectar o sinal; onde a detecção do sinal indica a presença do filamento estendido, e a presença da sequência de ácido nucleico alvo. [000254] In yet another aspect of the present invention, there is provided a method for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids by a PCE-SH assay (PTO Cleavage and Oligonucleotide Hybridization Dependent Signaling), comprising: a) hybridize the target nucleic acid sequence to a probe and target oligonucleotide (PTO); in which the PTO comprises (i) a target-3 'portion comprising a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5-labeled portion comprising a nucleotide sequence not complementary to the sequence target nucleic acid; in which the 3 'targeting portion of the PTO is hybridized to the target nucleic acid sequence, and the 5' labeling portion is not hybridized to the target nucleic acid sequence; b) contacting the resultant from step (a) to an enzyme having 5 'nuclease activity under conditions for cleavage of the PTO; in which the PTO is cleaved by the enzyme having 5 'nuclease activity, such that the cleavage releases a fragment comprising the 5' labeling portion, or a part of the 5 'labeling portion; c) hybridize the fragment released from the PTO with a capture and modeling oligonucleotide (CTO); in which the CTO comprises, in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and (ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion and the 3' targeting portion of the PTO; in which the fragment released from the PTO is hybridized to the capture portion of the CTO; d) carrying out an extension reaction using that resulting from step (c), and a model-dependent nucleic acid polymerase; in which the fragment hybridized to the capture portion of the CTO is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; e) hybridize the extended strand with a signaling oligonucleotide (SO); in which the SO comprises a sequence complementary to the extended filament, and at least one tag; the SO provides a signal detectable by hybridization with the extended filament; and f) detecting the signal; where the detection of the signal indicates the presence of the extended strand, and the presence of the target nucleic acid sequence.
[0255] [000255] Considering the amplification of target nucleic acid sequences and PTO cleavage efficiency, the PCE-SH assay of the present invention is preferably performed using upstream oligonucleotides. Nucleotide Variation Detection Process by a PCE-SH Assay
[0256] a) hibridizar uma sequência de ácido nucleico alvo com um oligonucleotídeo a montante, e um oligonucleotídeo de sondagem e alvo (PTO); no qual o oligonucleotídeo a montante compreende uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo; o PTO compreende (i) uma porção de direcionamento-3’ compreendendo uma hibridização da sequência de nucleotídeo complementar à sequência de ácido nucleico alvo, (ii) uma porção de etiquetagem-5’ compreendendo uma sequência de nucleotídeo não complementar à sequência de ácido nucleico alvo, e (iii) um sítio de discriminação da variação de nucleotídeo, compreendendo uma sequência complementar à variação de nucleotídeo no ácido nucleico alvo, posicionada em uma parte terminal-5’ da porção de direcionamento-3’; no qual a porção de direcionamento-3’ é hibridizada com a sequência de ácido nucleico alvo, e a porção de etiquetagem-5’ não é hibridizada com a sequência de ácido nucleico alvo; o oligonucleotídeo a montante está localizado a montante do PTO; o oligonucleotídeo a montante, ou seu filamento estendido, induz clivagem do PTO por uma enzima tendo a atividade de nuclease 5’; b) contatar a resultante da etapa (a) a uma enzima tendo uma atividade de nuclease 5’ sob condições para clivagem do PTO; no qual quando o PTO é hibridizado com a sequência de ácido nucleico alvo tendo a variação de nucleotídeo complementar ao sítio de discriminação da variação de nucleotídeo, e a parte terminal-5’ da porção de direcionamento-3’ forma um filamento duplo com a sequência de ácido nucleico alvo, para induzir clivagem de um primeiro sítio de clivagem inicial, um primeiro fragmento é liberado; no qual quando o PTO é hibridizado com uma sequência de ácido nucleico alvo tendo uma variação de nucleotídeo não complementar ao sítio de discriminação da variação de nucleotídeo, e a parte terminal-5’da porção de direcionamento-3’ não forma um filamento duplo com a sequência de ácido nucleico alvo, para induzir clivagem de um segundo sítio de clivagem inicial localizado a jusante do primeiro sítio de clivagem inicial, um segundo fragmento é liberado; no qual o segundo fragmento compreende uma porção de extremidade-3’ adicional permite o segundo fragmento diferente do primeiro fragmento; c) hibridizar o fragmento liberado a partir do PTO com um oligonucleotídeo de captura e modelagem(CTO); no qual o CTO compreende em uma direção 3’ a 5’, (i) uma porção de captura compreendendo uma sequência de nucleotídeo complementar à porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO, e (ii) uma porção de modelagem compreendendo uma sequência de nucleotídeo não complementar à porção de etiquetagem-5’ e à porção de direcionamento-3’ do PTO; no qual o primeiro fragmento, ou o segundo fragmento liberado a partir do PTO é hibridizado com a porção de captura do CTO; d) realizar uma reação de extensão usando a resultante da etapa (c), e uma polimerase de ácido nucleico dependente do modelo; no qual quando o primeiro fragmento é hibridizado com a porção de captura do CTO, ele é estendido para formar um filamento estendido compreendendo uma sequência estendida complementar à porção de modelagem do CTO; no qual quando o segundo fragmento é hibridizado com a porção de captura do CTO, ele não é estendido; e) hibridizar o filamento estendido com um oligonucleotídeo de sinalização (SO); no qual o SO compreende uma sequência complementar ao filamento estendido, e pelo menos uma etiqueta; o SO proporciona um sinal detectável pela hibridização com o filamento estendido; e f) detector o sinal; onde a detecção do sinal indica a presença da variação de nucleotídeo complementar ao sítio de discriminação de nucleotídeo do PTO. [000256] In a further aspect of the present invention, a method for detecting a variation of nucleotide in a target nucleic acid sequence is provided by a PCE-SH assay (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) , comprising: a) hybridize a target nucleic acid sequence with an upstream oligonucleotide, and a probe and target oligonucleotide (PTO); in which the upstream oligonucleotide comprises a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprises (i) a 3 'targeting portion comprising a hybridization of the nucleotide sequence complementary to the target nucleic acid sequence, (ii) a 5' tagging portion comprising a nucleotide sequence not complementary to the nucleic acid sequence target, and (iii) a nucleotide variation discrimination site, comprising a sequence complementary to the nucleotide variation in the target nucleic acid, positioned at a 5 'terminal part of the 3' targeting portion; in which the targeting portion-3 'is hybridized to the target nucleic acid sequence, and the labeling portion-5' is not hybridized to the target nucleic acid sequence; the upstream oligonucleotide is located upstream of the PTO; the upstream oligonucleotide, or its extended strand, induces cleavage of the PTO by an enzyme having 5 'nuclease activity; b) contacting the resultant from step (a) to an enzyme having a 5 'nuclease activity under conditions for cleavage of the PTO; in which when the PTO is hybridized to the target nucleic acid sequence having the nucleotide variation complementary to the discrimination site of the nucleotide variation, and the 5 'terminal part of the 3' targeting portion forms a double strand with the sequence of target nucleic acid, to induce cleavage from a first initial cleavage site, a first fragment is released; in which when the PTO is hybridized to a target nucleic acid sequence having a nucleotide variation not complementary to the discrimination site of the nucleotide variation, and the 5 'terminal part of the 3' targeting portion does not form a double strand with the target nucleic acid sequence, to induce cleavage of a second initial cleavage site located downstream of the first initial cleavage site, a second fragment is released; in which the second fragment comprises an additional 3 'end portion allows the second fragment to differ from the first fragment; c) hybridize the fragment released from the PTO with a capture and modeling oligonucleotide (CTO); in which the CTO comprises in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and ( ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion and the 3' targeting portion of the PTO; in which the first fragment, or the second fragment released from the PTO is hybridized to the capture portion of the CTO; d) carrying out an extension reaction using that resulting from step (c), and a model-dependent nucleic acid polymerase; in which when the first fragment is hybridized to the capture portion of the CTO, it is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO; in which when the second fragment is hybridized to the capture portion of the CTO, it is not extended; e) hybridize the extended strand with a signaling oligonucleotide (SO); in which the SO comprises a sequence complementary to the extended filament, and at least one tag; the SO provides a signal detectable by hybridization with the extended filament; and f) detecting the signal; where signal detection indicates the presence of the nucleotide variation complementary to the PTO nucleotide discrimination site.
[0257] [000257] The present inventors have found that the probe's cleavage site is adjustable, depending on the presence and absence of nucleotide variations of interest, and the fragments released by cleavage at different locations, are distinguished by the extensibility of an artificial model.
[0258] [000258] The present invention employs successive events, followed by probe hybridization; cleavage of the PTO and extension; formation of an extended filament dependent on the variation of the nucleotide; and detecting the extended filament using a signaling oligonucleotide. Therefore, it is called VD-PCE-SH assay (Detection of Variation by PTO Cleavage and Hybridization of Extension-Dependent Signaling Oligonucleotide).
[0259] [000259] According to one embodiment, the variation in nucleotide detected by the present invention is a variation by a single nucleotide, such as SNP.
[0260] [000260] In the present application, a target nucleic acid sequence having a nucleotide variation complementary to the PTO nucleotide variation discrimination site is also described as a "paired model". A target nucleic acid sequence having a nucleotide variation not complementary to the PTO nucleotide variation discrimination site is also described as a "mismatched model".
[0261] [000261] According to one embodiment, the term "non-complementary", in relation to a variation of nucleotide not complementary to the discrimination site of the nucleotide variation, is used here to involve non-complementarity due to insertion or deletion.
[0262] [000262] The VD-PCE-SH assay of the present invention uses the PTO having the nucleotide variation discrimination site positioned at the 5 'terminal part of the 3' targeting portion for PTO selectivity to a specific nucleotide variation . When the PTO is hybridized to the target nucleic acid sequence (i.e., paired model), with the nucleotide variation complementary to the discrimination site of the nucleotide variation, the 5 'terminal part of the 3' targeting portion forms a double filament with the paired model; however, when the PTO is hybridized to a target nucleic acid sequence (i.e., mismatched model), having a nucleotide variation not complementary to the discrimination site of the nucleotide variation, the 5 'terminal part of the targeting portion-3 'does not form a double filament with the mismatched model.
[0263] [000263] It should be noted that such distinct hybridization patterns in the nucleotide variation of interest are responsible for the differences in initial PTO cleavage sites, thereby producing two types of PTO fragments to give differentiation of signal depending on a presence of the nucleotide variation of interest.
[0264] [000264] A first fragment is generated by hybrid cleavage between the PTO and the paired model, and a second fragment is generated by hybrid cleavage between the PTO and the mismatched model, respectively. The second fragment comprises an additional 3 'end portion which makes the second fragment different from the first fragment.
[0265] [000265] The production of either the first fragment or the second fragment can be distinctly detected by an extension reaction in the CTO.
[0266] [000266] Generally, the hybridization between a 3 'end part of primers and a model, the extension of primers in a stringent condition is very crucial. In the present invention, the first fragment and the second fragment each are hybridized to the same site as the CTO. As described above, the second fragment comprises the additional 3 'end portion, compared to the first fragment. By adjusting the hybridization conditions and a CTO sequence opposite the additional 3 'end portion of the second fragment, only the first fragment can be allowed to extend.
[0267] [000267] According to one embodiment, the CTO has a selected sequence, such that the CTO is not hybridized to the additional 3 'end portion of the second fragment to prevent the second extension fragment when the second fragment is hybridized to the capture portion of the CTO.
[0268] [000268] According to one embodiment, the CTO sequence opposite the additional 3 'end portion of the second fragment is non-complementary to the additional 3' end portion.
[0269] [000269] The production of the extended filament by extension of the first fragment can be detected by the use of SO according to the present invention described above.
[0270] [000270] According to conventional technologies using 5 'nuclease activities to detect nucleotide variation, the hybridization of probes used is determined or affected by a complete probe sequence. In such conventional technologies, probe design and construction, and optimization of reaction conditions, are very problematic as probe hybridization dependent on the presence of nucleotide variations is compelled to be primarily determined by difference by a nucleotide.
[0271] [000271] According to the VD-PCE-SH assay, a nucleotide variation discrimination site is positioned in a 5 'terminal part of a probe portion involving hybridization, making the optimization of hybridization conditions to be convenient. In addition, the VD-PCE-SH assay differentially detects a variation of nucleotide by a local probe portion rather than a complete sequence of probes, such that the difference by even one nucleotide, such as SNPs, can be precisely detected.
[0272] [000272] It is known to one skilled in the art that a probe sequence adjacent to a sequence opposite an SNP greatly affects probe hybridization. Conventional probes have a sequence opposite to a SNP, usually in its middle portion. In this regard, conventional probes cannot select a surrounding sequence around an SNP involved in hybridization. Conventional technologies have serious limitations due to the sequences surrounding the SNPs.
[0273] [000273] The VD-PCE-SH assay of the present invention will be described in more detail as follows:
[0274] [000274] [0266] Since the VD-PCE-SH assay of the present invention is one of the applications of the PCE-SH assay described above, the common descriptions among them are omitted in order to avoid undue redundancy, leading to the complexity of this descriptive report. Step (a): Hybridization of an upstream oligonucleotide and a PTO with a target nucleic acid sequence
[0275] [000275] In accordance with the present invention, a target nucleic acid sequence is first hybridized to an upstream oligonucleotide and a PTO.
[0276] [000276] The PTO used in detecting nucleotide variations comprises (i) a 3 'targeting portion that serves as a probe, (ii) a 5' labeling portion with a nucleotide sequence not complementary to the acid sequence target nucleic acid, and (iii) a nucleotide variation discrimination site, comprising a sequence complementary to the nucleotide variation in the target nucleic acid, positioned at a 5 'terminal part of the 3' targeting portion. The 5 'labeling portion is nucleolytically released from the PTO after hybridization to the target nucleic acid sequence. The labeling portion-5 'and the targeting portion-3' on the PTO must be positioned in an order 5 'to 3'. The PTO is schematically illustrated in Fig. 9.
[0277] [000277] The PTO comprises the nucleotide variation discrimination site comprising a sequence complementary to the nucleotide variation positioned at a 5 'terminal part of the 3' targeting portion.
[0278] [000278] Where the PTO is hybridized to the target nucleic acid sequence having the nucleotide variation complementary to the variation discrimination site, the 5 'terminal part of the 3' targeting portion forms a double strand with the acid sequence target nucleic acid. Where the PTO is hybridized to a target nucleic acid sequence having a nucleotide variation not complementary to the variation discrimination site, the 5 'terminal part of the 3' targeting portion does not form a double strand with the nucleic acid sequence target. Such distinct hybridization patterns in the nucleotide variation of interest are responsible for differences in the PTO cleavage sites, thereby producing two types of PTO fragments to give differentiation of signal depending on a presence of the nucleotide variation of interest. The 5 'terminal part of the PTO 3' targeting portion can also be described as a single strand-forming 5 'end portion of the PTO 3' targeting portion when hybridized to a target nucleic acid sequence having a nucleotide variation not complementary to the variation discrimination site.
[0279] [000279] The nucleotide variation discrimination site positioned at a 5 'terminal part of the 3' targeting portion of the PTO comprises a sequence complementary to the nucleotide variation. For example, when a nucleotide variation to be detected is an SNP, the discrimination site of the nucleotide variation comprises a nucleotide complementary to the SNP.
[0280] [000280] According to one embodiment, the nucleotide variation discrimination site is located within 10 nucleotides, more preferably 8 nucleotides, even more preferably 6 nucleotides, even more preferably 4 nucleotides, 3 nucleotides, 2 nucleotides , or 1 nucleotide, away from the 5 'end of the 3' targeting portion of the PTO. Preferably, the nucleotide variation discrimination site is located at the 5 'end of the 3' targeting portion of the PTO.
[0281] [000281] The term "site" referring to a probe nucleotide variation discrimination site, or nucleotide variation site in the target sequences, is used here to involve not only a single nucleotide, but also a plurality of nucleotides .
[0282] [000282] Preferably, the hybridization in step (a) is carried out under stringent conditions that the targeting portion-3 'is hybridized to the target nucleic acid sequence, and the labeling portion-5' is not hybridized to the sequence of target nucleic acid. Step (b): Release a fragment from the PTO
[0283] [000283] Then, the resultant from step (a) is contacted with an enzyme having a 5 'nuclease activity under conditions for cleavage of the PTO.
[0284] [000284] When the PTO is hybridized to the target nucleic acid sequence (i.e., paired model) having the nucleotide variation complementary to the variation discrimination site, and the 5 'terminal part of the targeting portion-3' form a double strand with the target nucleic acid sequence, to induce cleavage from a first initial cleavage site, a first fragment is released (see Fig. 9).
[0285] [000285] Where the PTO is hybridized to a target nucleic acid sequence (i.e., mismatched model) having a nucleotide variation not complementary to the variation discrimination site, and the 5 'terminal part of the 3' targeting portion does not form a double strand with the target nucleic acid sequence, to induce cleavage of a second initial cleavage site located downstream of the first initial cleavage site, a second fragment is released; in which the second fragment comprises an additional 3 'end portion allows the second fragment to differ from the first fragment (see Fig. 9).
[0286] [000286] Where the target nucleic acid sequence is not present in a sample, cleavage of the PTO does not occur.
[0287] [000287] As such, differences in the cleavage sites and types of PTO fragments generated result in different extension patterns depending on a presence and absence of the nucleotide variation of interest in the target nucleic acid sequence, contributing to differential detection of the variation of nucleotide in the target nucleic acid sequence.
[0288] [000288] An upstream primer extension cleavage site is generally positioned in a 5 'to 3' direction on a double-stranded initial nucleotide (i.e., bifurcation site) in structures including a single strand and a double strand , or 1-2 nucleotides apart from the initial nucleotide. By the cleavage reaction, fragments comprising the labeling portion-5 'and a portion of the targeting portion-3' are produced. Where the present invention is accomplished by upstream oligonucleotide inducing cleavage regardless of extent, the PTO cleavage site can be adjusted by the location of upstream oligonucleotides.
[0289] [000289] The term used here "a first initial cleavage site", in conjunction with the PTO, means a PTO cleavage site being first cleaved when the PTO is hybridized to the target nucleic acid sequence having the complementary nucleotide variation to the variation discrimination site. The term used here "a second initial cleavage site", in conjunction with the PTO, means a PTO cleavage site being first cleaved when the PTO is hybridized to a target nucleic acid sequence having a nucleotide variation not complementary to the site variation discrimination.
[0290] [000290] The term used here "a first fragment" refers to a fragment produced after cleavage at the first initial cleavage site. The term is used, without restriction, with "a first segment" and "a first fragment of PTO". The term "a second fragment" here refers to a fragment produced after cleavage at the second initial cleavage site. The term is used, without distinction, with "a second segment" and "a second fragment of PTO".
[0291] [000291] Preferably, the first fragment and the second fragment each comprise the 5 'labeling portion, or a part of the 5' labeling portion.
[0292] [000292] Cleavage may occur successively after cleavage of the first initial cleavage site (or the second initial cleavage site), depending on the cleavage methods used. For example, where a 5 'nuclease cleavage reaction along with the upstream primer extension is used, the initial cleavage site and its successive sequence are cleaved. Where an upstream probe is used, and the cleavage reaction occurs at a site apart from a site where the probe is located, the cleavage reaction can occur only at the site, and cleavage at successive sites cannot occur.
[0293] [000293] According to one embodiment, an initial cleavage site dependent on the extension of upstream primers can be positioned in a 5 'to 3' direction on an initial double-stranded nucleotide (i.e., bifurcation site).
[0294] [000294] As shown in Fig. 9 representing an example of the present invention, the nucleotide variation discrimination site is positioned at the 5 'end of the 5' terminal part of the 3 'targeting portion. In this case, the first initial cleavage site is positioned immediately adjacent, in a direction 5 'to 3', to the terminal-5 'part of the targeting portion-3'. In other words, the first initial cleavage site is positioned immediately adjacent, in a 3 'direction, to the nucleotide variation discrimination site. The second initial cleavage site is generally positioned 1 nucleotide apart, in a 3 'direction, from the nucleotide variation discrimination site.
[0295] [000295] When the nucleotide variation discrimination site is positioned 1 nucleotide away from the 5 'end of the 5' terminal part of the 3 'targeting portion, the first initial cleavage site is positioned immediately adjacent, in a 5 'direction, to the nucleotide variation discrimination site. The second initial cleavage site is generally positioned 1 nucleotide away, in a 3 'direction, from the nucleotide variation discrimination site.
[0296] [000296] According to one embodiment, the terminal-5 'part may partially comprise a non-hybridizable sequence (or a base non-pairing sequence). The introduction of a non-hybridizable sequence at the 5 'terminal part is very advantageous over the formation of the single strand of the 5' terminal part when the PTO is hybridized to a target nucleic acid sequence having a nucleotide variation not complementary to the site of discrimination of nucleotide variation. In addition, the introduction of a non-hybridizable sequence causes the second initial cleavage site to be adjusted.
[0297] [000297] According to one embodiment, the 5 'terminal part of the 3' targeting portion of the PTO comprises a base mismatch portion located within 1-10 nucleotides (more preferably, 1-5 nucleotides) apart from the nucleotide variation discrimination site. The base mismatch fraction prevents the 5 'terminal part of the 3' targeting portion from forming a double strand with the target nucleotide sequence when the PTO is hybridized to the target nucleic acid sequence having the variation of nucleotide not complementary to the variation discrimination site.
[0298] [000298] The use of the base mismatch fraction (eg, mismatched nucleotide) enhances the potential of PTO discrimination for nucleotide variations.
[0299] [000299] According to one embodiment, the base mismatch portion does not exhibit the formation of a double strand between the 5 'terminal part and the target nucleic acid sequence when the PTO is hybridized to the target nucleic acid sequence having the nucleotide variation complementary to the nucleotide variation discrimination site.
[0300] [000300] According to one embodiment, the fraction of base mismatch widens the distance between the first initial cleavage site and the second initial cleavage site.
[0301] [000301] Preferably, the base mismatch fraction is located downstream of the nucleotide variation discrimination site.
[0302] [000302] For example, when a nucleotide mismatched as a base mismatch fraction is introduced at a position 2 nucleotides apart, in a 3 'direction, from the nucleotide variation discrimination site, the second initial cleavage site it is adjusted to a position 2 nucleotides away from the discrimination site of the nucleotide variation. If the mismatched nucleotide is not used, the second initial cleavage site is positioned 1 nucleotide away from the discrimination site of the nucleotide variation. That is, the base mismatch fraction can widen the distance between the first initial cleavage site and the second initial cleavage site.
[0303] [000303] The base mismatch fraction includes any fractions that do not form a base pair between target nucleic acid sequences. Preferably, the base mismatch portion is (i) a nucleotide comprising an artificial mismatch, a base mismatch modified to be incapable of base mismatch or a universal base, (ii) a mismatch nucleotide base modified to be incapable of base pairing, or (iii) a non-base chemical compound.
[0304] [000304] For example, the base non-pairing portion includes alkylene, ribofuranosyl naphthalene, deoxy ribofuranosyl naphthalene, metaphosphate, phosphorothioate bond, alkyl phosphotriester bond, aryl phosphotriester bond, alkyl phosphonate bond, aryl phosphonate bond, aryl phosphonate bond hydrogen phosphonate bond, alkyl phosphoramidate bond, and aryl phosphoramidate bond. Conventional carbon spacers are also used as base non-matching fractions. Universal bases as base non-matching fractions are useful in adjusting the PTO cleavage sites.
[0305] [000305] As base pairs containing universal bases, such as deoxyinosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrole and 5-nitroindole, have a lower bond strength than that between natural bases , universal bases can be employed as base mismatch portions under certain hybridization conditions.
[0306] [000306] The base mismatch portion introduced at the 5 'terminal part preferably has 1-10, more preferably 1-5, even more preferably 1-2 portions. A plurality of base mismatch fractions at the 5 'terminal part may be present in a consecutive or intermittent manner. Preferably, the base mismatch portion has 2-5 consecutive portions.
[0307] [000307] Preferably, the base mismatch portion is a chemical base mismatch.
[0308] [000308] According to one embodiment, the nucleotide variation discrimination site and the base mismatch portion of the PTO are located within 10 nucleotides (more preferably, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides or 1 nucleotide, even more preferably, 1 nucleotide) spaced from the 5 'end of the 3' targeting portion.
[0309] [000309] Alternatively, the cleavage reaction can be performed only at the first initial cleavage site, not at the second initial cleavage site. For example, where an upstream probe is used, and the cleavage reaction occurs at a site apart from a site where the probe is located, the cleavage reaction can occur only at the first initial cleavage site when the PTO is hybridized to the paired model. When the PTO is hybridized to the mismatched model, the bifurcation site (the second initial cleavage site) may not be cleaved because of a long distance from the upstream probe.
[0310] [000310] According to one embodiment, where the PTO is hybridized to the mismatched model, the second initial cleavage site comprises a double-stranded initial site (i.e., bifurcation site) in structures including a single filament and a filament double.
[0311] [000311] According to one embodiment, the PTO has a blocking portion containing as a blocker at least one nucleotide resistant to enzyme cleavage having 5 'nuclease activity, and the blocking portion is positioned at the second initial cleavage site. The blocking portion prevents cleavage at the second initial cleavage site and successive cleavages.
[0312] [000312] The number of blockers contained in the blocking portion can be unrestricted, preferably 1-10, more preferably 2-10, even more preferably 3-8, more preferably 3-6, blockers. The blockers present in the probes can be in a continuous or intermittent way, preferably in a continuous way. The nucleotides as blockers with a support resistant to 5 'to 3' exonuclease activity include anyone known to one skilled in the art. For example, it includes several phosphorothioate bonds, phosphonate bonds, phosphoramidate bonds and 2'-carbohydrate modifications. According to one embodiment, nucleotides having a 5 'to 3' exonuclease resistant support include phosphorothioate bond, alkyl phosphotriester bond, aryl phosphotriester bond, alkyl phosphonate bond, aryl phosphonate bond, hydrogen phosphonate bond, bond alkyl phosphoramidate, phosphoramidate bond, phosphoroselenate bond, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, α oligodeoxynucleotide -anomeric, and modification of l- (4'-thio-β-D-ribofuranosyl). Step (c): Hybridization of the fragment released from the PTO with CTO
[0313] [000313] The fragment released from the PTO is hybridized with a CTO (Capture and Modeling Oligonucleotide).
[0314] [000314] The first fragment and the second fragment commonly have a hybridizable sequence with the capture portion of the CTO and, thus, one of them is hybridized with the CTO.
[0315] [000315] The second fragment produced when hybridized to the mismatched model comprises an additional 3 'end portion being different from the first fragment produced when hybridized to the paired model.
[0316] [000316] According to one embodiment, the CTO has a selected sequence, such that the CTO is not hybridized to the additional 3 'end portion of the second fragment to prevent the second extension fragment when the second fragment is hybridized to the capture portion of the CTO. For example, the CTO sequence can be selected such that the CTO has a mismatched nucleotide opposite the additional 3 'end portion of the second fragment. Alternatively, universal bases can be used, instead of the mismatched nucleotide.
[0317] [000317] The first initial cleavage site (or the second initial cleavage site) may not be fixed, but, preferably, multiple in one condition. For example, the initial cleavage sites may be positioned in a 5 'to 3' direction on a double-stranded initial nucleotide (i.e., bifurcation site) in structures including a single and a double-stranded, and 1-2 nucleotides apart from the starting nucleotide. In such a case, preferably, the CTO sequence is selected such that the shortest fragment released by the first initial cleavage is selectively extended in the present invention, to generate the extended strand indicative of a presence of the nucleotide variation. Step (d): Fragment Extension
[0318] [000318] When the first fragment is hybridized to the capture portion of the CTO, it is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO. When the second fragment is hybridized to the capture portion of the CTO, it is not extended.
[0319] [000319] Generally, the extension of primers can be controlled by hybridization between a 3 'end portion of primers and a template. By adjusting the primer sequences and reaction conditions (e.g., annealing temperature), the extension of primers, having in their end part-3 '1 to 3 mismatched nucleotides, is permissible. Alternatively, the extension of primers may be permissible only when they have a sequence perfectly complementary to the target sequences.
[0320] [000320] According to one modality, the CTO sequence is selected, which, either the first fragment, or the second fragment, is selectively extended.
[0321] [000321] According to one embodiment, the fragment is extended under conditions such that the extension does not occur even when a single mismatch is present at the 3 'end part of the fragment. Step (e): Signal Generation by Hybridization between the extended filament and SO
[0322] [000322] Following the extension reaction, the extended filament is hybridized with a signaling oligonucleotide (SO). The signal indicative of a presence of the nucleotide variation complementary to the PTO nucleotide discrimination site is provided.
[0323] [000323] Details of hybridization between the extended filament and the SO, labeling and signal generation systems will be described with reference to the descriptions indicated above. Step (f): Signal Detection
[0324] [000324] Finally, the detectable signal provided in step (e) is detected, where the detection of the signal indicates the presence of the extended filament, and the presence of the nucleotide variation complementary to the PTO nucleotide discrimination site.
[0325] [000325] Details of the signal detection will be described with reference to the descriptions indicated above.
[0326] [000326] According to one embodiment, the present invention for detecting nucleotide variation can be carried out with no help from upstream oligonucleotides. Enzymes having upstream oligonucleotide-dependent 5'-nuclease activity are used. Considering the amplification of the target nucleic acid sequences, the reaction conditions and 5 'nuclease activity, the present invention is preferably carried out using upstream oligonucleotides, more preferably, upstream primers. Target Detection Kits
[0327] a) um oligonucleotídeo de sondagem e de alvo (PTO); no qual o PTO compreende (i) uma porção de direcionamento-3’ compreendendo uma hibridização de uma sequência de nucleotídeo complementar à sequência de ácido nucleico alvo, e (ii) uma porção de etiquetagem-5’ compreendendo uma sequência de nucleotídeo não complementar à sequência de ácido nucleico alvo; no qual a porção de direcionamento-3’ do PTO é hibridizada com a sequência de ácido nucleico alvo, e a porção de etiquetagem-5’ não é hibridizada com a sequência de ácido nucleico alvo; b) um oligonucleotídeo a montante compreendendo uma hibridização de uma sequência de nucleotídeo complementar à sequência de ácido nucleico alvo; no qual o oligonucleotídeo a montante está localizado a montante do PTO; no qual o oligonucleotídeo a montante, ou seu filamento estendido, induz clivagem do PTO por uma enzima tendo a atividade de nuclease 5’, tal que a clivagem libera um fragmento compreendendo a porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO; c) um oligonucleotídeo de captura e modelagem(CTO); no qual o CTO compreende, em uma direção 3’ a 5’, (i) uma porção de captura compreendendo uma sequência de nucleotídeo complementar à porção de etiquetagem-5’, ou uma parte da porção de etiquetagem-5’ do PTO, e (ii) uma porção de modelagem compreendendo uma sequência de nucleotídeo não complementar à porção de etiquetagem-5’ e à porção de direcionamento-3’ do PTO; no qual o fragmento liberado a partir de PTO é hibridizado com a porção de captura do CTO; no qual o fragmento hibridizado com a porção de captura do CTO é estendido para formar um filamento estendido compreendendo uma sequência estendida complementar à porção de modelagem do CTO, formando, desse modo, um duplex estendido; e d) um oligonucleotídeo de sinalização (SO); no qual o SO compreende uma sequência complementar ao filamento estendido, e pelo menos uma etiqueta; o SO proporciona um sinal detectável por hibridização com o filamento estendido. [000327] In a further aspect of this invention, a kit is provided for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids by a PCE-SH assay (PTO Cleavage and Oligonucleotide Hybridization) Extension Dependent Signaling), comprising: a) a probe and target oligonucleotide (PTO); in which the PTO comprises (i) a 3 'targeting portion comprising a hybridization of a nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5' labeling portion comprising a nucleotide sequence not complementary to the target nucleic acid sequence; in which the 3 'targeting portion of the PTO is hybridized to the target nucleic acid sequence, and the 5' labeling portion is not hybridized to the target nucleic acid sequence; b) an upstream oligonucleotide comprising a hybridization of a nucleotide sequence complementary to the target nucleic acid sequence; in which the upstream oligonucleotide is located upstream of the PTO; in which the upstream oligonucleotide, or its extended strand, induces cleavage of the PTO by an enzyme having 5 'nuclease activity, such that the cleavage releases a fragment comprising the 5' tag portion, or a part of the tag portion -5 'from the PTO; c) a capture and modeling oligonucleotide (CTO); in which the CTO comprises, in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO, and (ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion and the 3' targeting portion of the PTO; in which the fragment released from PTO is hybridized to the capture portion of the CTO; in which the fragment hybridized to the capture portion of the CTO is extended to form an extended filament comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; and d) a signaling oligonucleotide (SO); in which the SO comprises a sequence complementary to the extended filament, and at least one tag; the SO provides a detectable signal by hybridization with the extended filament.
[0328] [000328] Since the kit of this invention is built to perform the detection method of the present invention described above, the common descriptions between them are omitted in order to avoid undue redundancy, leading to the complexity of this specification.
[0329] [000329] According to one embodiment, at least a portion of the SO comprises a sequence complementary to the extended sequence.
[0330] [000330] According to one embodiment, the kit comprises (i) the tag linked to the SO, (ii) a tag combined to the OS, and a tag linked to the fragment from PTO, (iii) a tag combination linked to the SO, and a tag to be incorporated into the extended filament, or (iv) a combination of the SO linked tag and an intercalating dye.
[0331] [000331] According to one embodiment, the SO is tagged with an interactive double tag comprising a reporter molecule and a suppressor molecule.
[0332] [000332] According to one modality, the OS is labeled with a single label.
[0333] [000333] According to one embodiment, the kit additionally comprises an additional SO comprising a sequence complementary to the extended filament, the two SOs are hybridized to the extended filament in an adjacent manner, the two SOs each comprise a tag between a reporter molecule and a molecule that suppresses an interactive double tag.
[0334] [000334] According to one embodiment, the SO comprises a tag between a reporter molecule and a suppressor molecule of an interactive double tag, and the fragment from PTO comprises the other tag between the reporter molecule and the suppressor molecule.
[0335] [000335] According to one embodiment, the SO comprises a tag between a reporter molecule and a suppressor molecule for an interactive double tag, and the modeling portion of the CTO comprises a nucleotide having a first unnatural base; in which the kit additionally comprises a nucleotide having both a second unnatural base with a specific binding affinity, the first unnatural base, and the other between the reporter molecule and the suppressor molecule.
[0336] [000336] According to one embodiment, the SO comprises a tag between a reporter molecule and a suppressor molecule of an interactive double tag, and the kit additionally comprises a nucleotide having the other between the reporter molecule and the suppressor molecule.
[0337] [000337] According to one embodiment, the SO comprises a FRET acceptor (fluorescence resonance energy transfer), and the kit additionally comprises an intercalating dye.
[0338] [000338] According to one modality, the PTO, CTO and / or SO are blocked at their 3 'end, to prevent their extension.
[0339] [000339] According to one embodiment, the upstream oligonucleotide is an upstream primer, or an upstream probe.
[0340] [000340] According to one embodiment, the kit additionally comprises an enzyme having 5 'nuclease activity.
[0341] [000341] According to one embodiment, the kit is for detecting at least two types of target nucleic acid sequences; in which the upstream oligonucleotide comprises at least two types of oligonucleotides, the PTO comprises at least two types of the PTOs, the CTO comprises at least two types of the CTOs, and the SO comprises at least two types of the SOs.
[0342] [000342] According to one embodiment, the kit additionally comprises a downstream initiator.
[0343] a) A presente invenção não usa sondas a serem hibridizadas com as sequências de ácido nucleico alvo para proporcionar sinais-alvo. Interessantemente, a presente invenção usa sondas (oligonucleotídeos de sinalização) a serem hibridizadas com o filamento estendido formado em uma maneira dependente do alvo em que o filamento estendido é sintetizado usando o CTO artificialmente selecionado com os modelos. A presente invenção emprega primeiramente o PTO para sondagem de sequências de ácido nucleico alvo e, em seguida, em segundo lugar, o SO para proporcionar sinais por hibridização com o filamento estendido dependente do alvo, contribuindo para aumento dramático na especificidade, e muito melhor conveniência na determinação das condições de reação pelo ajuste das condições para geração de sinal, independente das sequências de ácido nucleico alvo. Tais características permitem que as condições para geração de sinal sejam mais prontamente estabelecidas em detecção-alvo de multiplex simultânea em diversas amostras clínicas, e sinais positivos falsos a serem impedidos. b) Nas tecnologias convencionais usando sondas a serem hibridizadas com sequências de ácido nucleico alvo, as sondas são hibridizadas com sequências de ácido nucleico alvo em competição com sequências complementares de sequências de ácido nucleico alvo. Contudo, a presente invenção é capaz de amplificar somente o filamento estendido usando uma quantidade controlada do CTO como modelos e, portanto, assegura hibridização eficiente de sondas, tornando possível dar eficientemente sinais indicativos de uma presença de sequências de ácido nucleico alvo. c) A presente invenção pode detectar a presença de sequências de ácido nucleico alvo em uma maneira de tempo real, ou por uma análise de fusão. d) O valor Tm da hibridização resultante entre o filamento estendido e o SO pode ser ajustável por uma sequência e/ou comprimento do SO e, portanto, arbitrariamente predeterminado. Pelo uso de tal característica, (i) a presente invenção pode detectar sequências de ácido nucleico alvo com diferenciação de sinais positivos falsos porque os sinais gerados em temperaturas outras do que os valores Tm predeterminados correspondem a sinais positivos falsos, (ii) a determinação arbitrária de valores Tm da hibridização resultante torna-se mais vantajosa em detecção de multiplex para pelo menos duas sequências de ácido nucleico alvo. e) O valor Tm de análise de curva de fusão convencional de híbrido entre uma sonda e uma sequência de ácido nucleico alvo, é afetado por uma variação de sequência na sequência de ácido nucleico alvo. Contudo, um filamento estendido na presente invenção proporciona um valor Tm constante indiferente de uma variação de sequência nas sequências de ácido nucleico alvo, permitindo assegurar excelente precisão na análise de curva de fusão. f) É de salientar que as sequências da porção de etiquetagem-5’ do PTO, do CTO e do SO, podem ser selecionadas com nenhuma consideração de sequências de ácido nucleico alvo. Isto torna possível pré-projetar uma reunião de sequências para a porção de etiquetagm-5’ do PTO, do CTO e do SO. Embora a porção de direcionamento-3’ do PTO tenha que ser preparada com consideração das sequências de ácido nucleico alvo, o CTO e o SO podem ser preparados em um modo pronto com nenhuma consideração ou conhecimento de sequências de ácido nucleico alvo. g) Uma ampla variedade das sondas etiquetadas convencionais são aplicáveis à presente invenção para detecção-alvo. h) Onde as hibridizações resultantes entre os filamentos estendidos e os SOs têm valores Tm diferentes entre si, pelo menos duas sequências de ácido nucleico alvo podem ser detectadas por análise de curva de fusão mesmo usando um sistema de etiquetagem que proporciona sinais com as mesmas características de fluorescência. A vantagem permite serem livres de limitações associadas com o número de etiquetas de fluorescência detectáveis em detecção de tempo real de multiplex. [000343] The characteristics and advantages of this invention will be summarized as follows: a) The present invention does not use probes to be hybridized to the target nucleic acid sequences to provide target signals. Interestingly, the present invention uses probes (signaling oligonucleotides) to be hybridized to the extended filament formed in a target-dependent manner in which the extended filament is synthesized using the CTO artificially selected with the models. The present invention first employs the PTO to probe target nucleic acid sequences and then, secondly, the SO to provide hybridization signals with the target-dependent extended strand, contributing to dramatic increase in specificity, and much better convenience in determining the reaction conditions by adjusting the conditions for signal generation, regardless of the target nucleic acid sequences. Such characteristics allow the conditions for signal generation to be more readily established in simultaneous multiplex target detection in several clinical samples, and false positive signals to be prevented. b) In conventional technologies using probes to be hybridized to target nucleic acid sequences, the probes are hybridized to target nucleic acid sequences in competition with complementary sequences of target nucleic acid sequences. However, the present invention is capable of amplifying only the extended strand using a controlled amount of the CTO as models and, therefore, ensures efficient hybridization of probes, making it possible to efficiently give signals indicative of the presence of target nucleic acid sequences. c) The present invention can detect the presence of target nucleic acid sequences in a real-time manner, or by a fusion analysis. d) The Tm value of the resulting hybridization between the extended filament and the SO can be adjustable by a sequence and / or length of the SO and, therefore, arbitrarily predetermined. By using such a feature, (i) the present invention can detect target nucleic acid sequences with differentiation of false positive signals because signals generated at temperatures other than predetermined Tm values correspond to false positive signals, (ii) arbitrary determination of Tm values of the resulting hybridization becomes more advantageous in multiplex detection for at least two target nucleic acid sequences. e) The Tm value of conventional hybrid fusion curve analysis between a probe and a target nucleic acid sequence is affected by a sequence variation in the target nucleic acid sequence. However, an extended filament in the present invention provides a constant Tm value regardless of a sequence variation in the target nucleic acid sequences, allowing to ensure excellent accuracy in the melt curve analysis. f) It should be noted that the 5 'tag portion of the PTO, CTO and SO sequences can be selected with no consideration of target nucleic acid sequences. This makes it possible to pre-design a sequence pool for the 5 'tag portion of the PTO, CTO and SO. Although the 3 'targeting portion of the PTO has to be prepared with consideration of the target nucleic acid sequences, the CTO and SO can be prepared in a ready mode with no consideration or knowledge of the target nucleic acid sequences. g) A wide variety of conventional labeled probes are applicable to the present invention for target detection. h) Where the resulting hybridizations between the extended filaments and the SOs have different Tm values, at least two target nucleic acid sequences can be detected by melting curve analysis even using a labeling system that provides signals with the same characteristics fluorescence. The advantage allows them to be free of limitations associated with the number of fluorescence tags detectable in real-time multiplex detection.
[0344] [000344] The present invention will now be described in further detail by way of examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative, and the scope of the present invention, as stated in the appended claims, is not limited to, or by, the examples. EXAMPLES EXAMPLE 1: Evaluation of PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization Assay (PCE-SH)
[0345] [000345] A New Assay, PTO Cleavage Assay and Extension-Dependent Signaling Oligonucleotide (PCE-SH) Assay, has been evaluated for the detection of a target nucleic acid sequence in a way of (i) real-time detection at a predetermined temperature, or (ii) melting analysis (see Fig. 2).
[0346] [000346] Taq DNA polymerase having a 5 'nuclease activity was used for the extension of an upstream primer, the cleavage of PTO, and the extension of PTO fragment.
[0347] [000347] The PTO and CTO have no label. The PTO and CTO are blocked with a carbon spacer at their 3 'ends. The synthetic oligonucleotide for the Neisseria gonorrhoeae (NG) gene was used as a target model. The signaling oligonucleotide (SO) has a fluorescent reporter molecule (CAL Fluor Red 610) at its 5 'end, and has a suppressor molecule (BHQ-2) at its 3' end.
[0348] [000348] The synthetic model sequences, upstream initiator, PTO, CTO, and SO, used in this Example are: NG-T 5'-AMTATGCGAAACACGCCAATGAGGGGCATGATGCIIICIIII IGTTCTTGCTCGGCAGAGCGAGTGATACCGATCCATTGAAAAA-3 '(SEQ ID NO: 1) NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2) NG-PTO 5'-ACGACGGC] TGGCTGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 3) NG-CTO 5'-GCGCTGGATACCCTGGACGATATGCAGCCAAGCCGTCGT [C3 spacer] -3 '(SEQ ID NO: 4) NG-SO-1 5 '- [CAL Fluor Red 610] GCGCTGGATACCCTGGACGATATG [BHQ-2] -3' (SEQ ID NO: 5) (Underlined letters indicate the 5 'labeling portion of the PTO) 1-1. Real-time detection at a predetermined temperature
[0349] [000349] The reaction was carried out in the final volume of 20 μl containing 2 pmoles of synthetic model (SEQ ID NO: 1) for NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO ( SEQ ID NO: 3), 0.5 pmoles of CTO (SEQ ID NO: 4), 0.5 pmole of SO (SEQ ID NO: 5), and 10 μΙ of 2X Master Mix containing 2.5 mM MgCl2, 200 pM dNTPs and 1.6 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C, and subjected to 30 cycles of 30 sec at 95 ° C, 60 sec at 60 ° C, and 30 sec at 72 ° C. The detection of the generated signal was performed in the hybridization stage (60 ° C) of each cycle. The detection temperature was determined to the extent that the hybrid extended strand of SO maintains a double-stranded shape.
[0350] [000350] As shown in Figure 10A, the fluorescent signal was detected in the presence of the model. No signal was detected in the absence of the model, PTO, CTO or SO. 1-2. Fusion analysis
[0351] [000351] After the reaction in Example 1-1, the melting curve was obtained by cooling the reaction mixture to 55 ° C, holding at 55 ° C for 30 sec, and heating slowly to 55 ° C to 85 ° C. Fluorescence was measured continuously during temperature rise to monitor dissociation of an extended-hybrid SO filament. The melting peak was derived from the data on the melting curve data.
[0352] [000352] As shown in Figure 10B, a peak at 68.5 ° C corresponding to the expected Tm value of the extended-hybrid filament of SO, was detected in the presence of the model. No peak was detected in the absence of the models, PTO, CTO or SO. EXAMPLE 2: Detection of a target nucleic acid sequence using PCE-SH assay
[0353] [000353] Additionally, it was examined whether the PCE-SH assay can detect a target nucleic acid sequence in (i) a real-time PCR way, or (ii) in a post-PCR fusion analysis way.
[0354] [000354] Taq DNA polymerase having a 5 'nuclease activity was used for upstream and downstream primer extension, PTO cleavage and PTO fragment extension.
[0355] [000355] The PTO and CTO have no label. The PTO and CTO are blocked with a carbon spacer at their 3 'ends. Genomic DNA from the NG gene was used as a target model. The SO has a fluorescent reporter molecule (CAL Fluor Red 610) at its 5 'end, and has a suppressor molecule (BHQ-2) at its 3' end.
[0356] [000356] The upstream, downstream primer, PTO, CTO and SO sequences used in this Example are: NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 6) NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2) NG-PTO 5'-ACGACGGCTTGGCTGCCCCTCATrGGCGTGTTTCGFC3 spacer] -3 '(SEQ ID NO: 3) NG-CTO 5'-GCGCTGGATACCCTGGACGATATGCAGCC7VAGCCGTCGT [C3 spacer] -3 '(SEQ ID NO: 4) NG-SO-1 5 '- [CAL Fluor Red 610] GCGCTGGATACCCTGGACGATATG [BHQ-2] -3' (SEQ ID NO: 5) (The underlined letters indicate the 5 'labeling portion of the PTO) 2-1. Real-time detection at a predetermined temperature during PCR
[0357] [000357] The reaction was conducted in the final 20 μl volume containing 100 pg of NG genomic DNA, 10 pmoles of upstream primer (SEQ ID NO: 2), 10 pmoles of downstream primer (SEQ ID NO: 6), 5 pmoles of PTO (SEQ ID NO: 3), 0.5 pmole of CTO (SEQ ID NO: 4), 0.5 pmole of SO (SEQ ID NO: 5) and 10 μl of 2X Master Mix containing 2.5 mM MgCl2, 200 μΜ dNTPs, and 1.6 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C, and subjected to 50 cycles of 30 sec at 95 ° C, 60 sec at 60 ° C, and 30 sec at 72 ° C. The signal detection was performed in the hybridization stage (60 ° C) of each cycle. The detection temperature was determined to the extent that the extended-hybrid filament of SO maintains a double filament shape.
[0358] [000358] As shown in Figure 11A, the fluorescent signal (Ct: 30.34) was detected in the presence of the model. No signal was detected in the absence of the model. 2-2. Post-PCR fusion analysis
[0359] [000359] After the reaction in Example 2-1, the melting curve was obtained by cooling the reaction mixture to 55 ° C, holding at 55 ° C for 30 sec, and heating slowly to 55 ° C to 85 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of an extended-hybrid SO filament. The melting peak was derived from the melting curve data.
[0360] [000360] As shown in Figure 11B, a peak at 68.5 ° C corresponding to the expected Tm value of the extended-hybrid filament of SO was detected in the presence of the model. No peak was detected in the absence of the model. EXAMPLE 3: Discrimination of a single nucleotide variation of a target nucleic acid sequence using PCE-SH
[0361] [000361] Additionally, it was examined whether the PCE-SH assay can discriminate a single nucleotide variation from a target nucleic acid sequence.
[0362] [000362] Taq DNA polymerase having a 5 'nuclease activity was used for upstream and downstream primer extension, PTO cleavage and PTO fragment extension. PTO and CTO have no label. The PTO and CTO are blocked with a carbon spacer at their 3 'ends. Human genomic DNAs wild type (C), hetero type (C / T) and mutant type (T) for C677T mutation of MTHFR gene were used as target nucleic acids. The SO has a suppressor molecule (BHQ-2) at its 5 'end, and has a fluorescent reporter molecule (CAL Fluor Red 610) at its 3' end.
[0363] [000363] PTO-1 (SEQ ID NO: 9) and CTO-1 (SEQ ID NO: 11) were used to detect wild type, and PTO-2 (SEQ ID NO: 10) and CTO-2 (SEQ ID NO: 12) used to detect the mutant type. Where the wild type gene was present, the extended strand (hereinafter referred to as "extended wild type strand") was formed using CTO-1 as a model. In the event that the mutant-like gene was present, the extended strand (hereinafter referred to as "extended mutant-type strand") was formed using CTO-2 as a template. In the detection of the hybridization products between the extended filaments and the SOs by a fusion analysis, the two types of the extended filaments can be differentially detected even using one type of the SO. For example, where the extended filaments are designed to have different sequences from each other in a portion to be hybridized with the SOs, the hybridization products have different Tm values that enable differentially to detect the formation of extended filaments.
[0364] [000364] The upstream, downstream primer, PTO, CTO and SO sequences used in this Example are: M677-F 5'-GCAGGGAGCTTTGAGGCTGIIIIIMGCACTTGA-3 '(SEQ ID NO: 7) M677-R 5'-CCTCACCTGGATGGGAAAGATIIIIIGGACGATGG-3 '(SEQ ID NO: 8) M677-PTO-1 5'-CCCAGGCAACCCTCCGATTTCATCATCACGCAGCI11ICI11GAGGC T [Spacer C3] -3 '(SEQ ID NO: 9) M677-PTO-2 5'-CTCCTCCTp3CCTACrCCCGCAGACACCrrCTCCTrCAAG [Spacer C3] -3 '(SEQ ID NO: 10) M677-CTO-1 5'-TCCGCTGCTTCACCACGCCTTCGAGAGGGTTGCCTGGG [Space C3] -3 '(SEQ ID NO: H) M677-CTO-2 5'-TCCGCTGCTTGACGACGCCTTCGATACGCGAGCAGGAG [Space C3] -3 '(SEQ ID NO: 12) M677-SO 5'- [BHQ-2] TCCGCTGCTTCACCACGCCTTCGA [CAL Red 610] -3 '(SEQ ID NO: 13) (I: Deoxyinosine) (The underlined letters indicate the 5 'labeling portion of the PTO) (The bold type indicates the sequence at the C677T mutation site of the MTHFR gene)
[0365] [000365] The reaction was conducted in the final volume of 20 μΙ containing 30 ng of MTHFR (C677T) human genomic DNA wild type (C), hetero type (C / T) or mutant type (T), 10 pmoles of primer a upstream (SEQ ID NO: 7), 10 pmoles of downstream initiator (SEQ ID NO: 8), each 5 pmoles of PTOs (SEQ ID NO: 9 and 10), each 0.1 pmole of CTOs (SEQ ID NO: 11 and 12), 0.5 pmole of SO (SEQ ID NO: 13) and 10 μl of 2X Master Mix containing 2.5 mM MgCl2, 200 pM dNTPs, and 1.6 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 40 cycles of 30 sec at 95 ° C, 60 sec at 55 ° C, and 30 sec at 72 ° C. After the reaction, the melting curve was obtained by cooling the reaction mixture to 45 ° C, holding at 45 ° C for 30 sec, and heating slowly to 45 ° C to 85 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of an extended-hybrid SO filament. The melting peak was derived from the melting curve data.
[0366] [000366] As shown in Figure 12, a peak at 71.0 ° C corresponding to the expected Tm value of the extended wild-hybrid SO filament was detected in the presence of the wild type model. A peak at 55.5 ° C corresponding to the expected Tm value of the extended mutant-hybrid SO filament was detected in the presence of the mutant-type model. A peak at 71.0 ° C (wild type), and a peak at 55.5 ° C (mutant type) were detected in the presence of the hetero model. No spikes were detected in the absence of any types of models. EXAMPLE 4: Evaluation of PCE-SH assay using PTO cleavage independent of the upstream oligonucleotide
[0367] [000367] PCE-SH assay was further evaluated for the detection of a target nucleic acid sequence without using upstream oligonucleotide in (i) real-time detection at a predetermined temperature, or (ii) by fusion analysis.
[0368] [000368] Taq DNA polymerase having a 5 'nuclease activity was used for PTO cleavage, and PTO fragment extension.
[0369] [000369] PTO and CTO have no label. The PTO and CTO are blocked with a carbon spacer at their 3 'ends. The synthetic oligonucleotide for the Neisseria gonorrhoeae (NG) gene was used as a target model. The SO has a fluorescent reporter molecule (CAL Fluor Red 610) at its 5 'end, and has a suppressor molecule (BHQ-2) at its 3' end.
[0370] [000370] The synthetic model, PTO, CTO and SO strings used in this Example are: NG-T 5'-AAATATGCGAAACACGCCAATGAGGGGCATGATGCIIICIIIIIGIICIIGCTCGGCAGAGCGAGTGATACCGATCCATTGAAAM-3 '(SEQ ID NO: 1) NG-PTO 5'-ACGACGGaTGGCTGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 3) NG-CTO 5'-GCGCTGGATACCCTGGACGATATGCAGCCAAGCCGTCGT [C3espa çador] -3 '(SEQ ID NO: 4) NG-SO-1 5 '- [CAL Fluor Red 610] GCGCTGGATACCCTGGACGATATG [BHQ-2] -3' (SEQ ID NO: 5) (The underlined letters indicate the 5 'labeling portion of the PTO) 4-1. Real-time detection at a predetermined temperature
[0371] [000371] The reaction was carried out in the final volume of 20 μΙ containing 2 pmoles of synthetic model (SEQ ID NO: 1) for NG gene, 5 pmoles of PTO (SEQ ID NO: 3), 0.5 pmole of CTO ( SEQ ID NO: 4), 0.5 pmoles of SO (SEQ ID NO: 5) and 10 μl of 2X Master Mix containing 2.5 mM MgCl2, 200 μΜ of dNTPs, and 1.6 units of DNA H polymerase -Taq DNA (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, BioRad); the reaction mixture was denatured for 15 min at 95 ° C, and subjected to 30 cycles of 30 sec at 95 ° C, 60 sec at 60 ° C, and 30 sec at 72 ° C. The detection of the generated signal was performed in the hybridization stage (60 ° C) of each cycle. The detection temperature was determined to the extent that the extended-hybrid filament of SO maintains a double filament shape.
[0372] [000372] As shown in Figure 13A, the fluorescent signal was detected in the presence of the model. No signal was detected in the absence of the model. 4-2. Fusion analysis
[0373] [000373] After the reaction in Example 4-1, the melting curve was obtained by cooling the reaction mixture to 55 ° C, holding at 55 ° C for 30 sec, and heating slowly to 55 ° C to 85 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of an extended-hybrid SO filament. The melting peak was derived from the melting curve data.
[0374] [000374] As shown in Figure 13B, a peak at 68.5 ° C corresponding to the expected Tm value of the extended-hybrid filament of SO was detected in the presence of the model. No peak was detected in the absence of the model.
[0375] [000375] Having described an embodiment of the present invention, it is to be understood that variants and modifications thereof that fall within the spirit of the invention may become apparent to those skilled in the art, and the scope of this invention is to be determined by the appended claims. and their equivalents.

权利要求:
Claims (22)
[0001]
Method for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids by PCE-SH assay (PTO cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization) in a liquid phase, characterized by the fact that which comprises: (a) hybridizing the target nucleic acid sequence to a probe and target oligonucleotide (PTO); wherein the PTO comprises (i) a target 3 'portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5' labeling portion comprising the nucleotide sequence not complementary to the sequence target nucleic acid; wherein the 3 'targeting portion of the PTO is hybridized to the target nucleic acid sequence, and the 5' targeting portion is not hybridized to the target nucleic acid sequence; (b) contacting the resultant from step (a) to an enzyme having a 5 'nuclease activity under conditions for PTO cleavage; (c) hybridize the fragment released from the PTO with a capture and modeling oligonucleotide (CTO); wherein the CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a part of the 5' labeling portion of the PTO and, (ii ) a modeling portion comprising a nucleotide sequence not complementary to the 5 'labeling portion and the 3' targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; (d) carrying out an extension reaction using that resulting from step (c) and a model-dependent nucleic acid polymerase; wherein the fragment hybridized to the capture portion of the CTO is extended to form an extended ribbon comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; (e) hybridizing the extended strand sequence to a signaling oligonucleotide (SO); wherein the SO comprises a sequence complementary to the extended sequence of the extended tape, and at least one tag; the SO provides a signal detectable by hybridization with the extended sequence of the extended tape; without which the OS is blocked at its 3 'end to prevent its extension; and (f) detecting the signal in a liquid phase; whereby the detection of the signal indicates the presence of the extended ribbon, and the presence of the target nucleic acid sequence; where the CTO and SO are not immobilized on a solid substrate; wherein the detectable signal is provided by (i) the OS-linked marker, (ii) a combination of the OS-linked marker and a marker linked to the PTO fragment, (iii) a combination of the OS-linked marker and a marker a be incorporated into the extended ribbon during the extension reaction of step (d), or (iv) a combination of the marker attached to the SO and an intercalating dye.
[0002]
Method, according to claim 1, characterized by the fact that step (a) of the method is carried out in the presence of an upstream oligonucleotide; wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence and the upstream oligonucleotide is located upstream of the PTO; and wherein the upstream oligonucleotide or its extended ribbon induces cleavage of the PTO by the enzyme with the 5 'nuclease activity so that the cleavage releases a fragment comprising the 5' tag portion or a part of the 5 'tag portion of the PTO.
[0003]
Method, according to claim 1, characterized by the fact that the SO is marked with an interactive double marker comprising a reporter molecule and a suppressor molecule, and the hybridization between the SO and the strip extended in step (e) induces change in the signal from the interactive double marker, to provide the detectable signal.
[0004]
Method, according to claim 1, characterized by the fact that the SO is marked with a unique marker, and the hybridization between the SO and the tape extended in step (e) induces change in the signal from the unique marker, to provide the detectable signal.
[0005]
Method according to claim 1, characterized by the fact that it uses an additional OS comprising a sequence complementary to the extended ribbon, the two SOs are hybridized with the ribbon extended in an adjacent manner, the two SOs each comprise a marker between a reporter molecule and a suppressor molecule for an interactive double marker; and the hybridization between the two SOs and the extended ribbon induces change in the signal from the interactive double marker, to provide the detectable signal.
[0006]
Method according to claim 1, characterized by the fact that the SO comprises a marker between a reporter molecule and a suppressor molecule of an interactive double marker, the PTO fragment comprises the other marker between the reporter molecule and the suppressor molecule; the extended ribbon comprises the marker originating from the PTO fragment, and where hybridization between the SO and the extended ribbon induces change in the signal from the interactive double marker, to provide the detectable signal.
[0007]
Method according to claim 1, characterized in that the SO comprises a marker between a reporter molecule and a suppressor molecule of an interactive double marker, and the modeling portion of the CTO comprises a nucleotide having a first unnatural base; wherein the extension reaction in step (d) is carried out in the presence of a nucleotide that has a second unnatural base with a specific binding affinity to the first unnatural base, and the other between the reporter molecule and the suppressor molecule, incorporating , thereby, the marker on the extended ribbon; wherein the hybridization between the SO and the extended ribbon induces change in the signal from the interactive double marker, to provide the detectable signal.
[0008]
Method according to claim 1, characterized by the fact that the SO comprises a marker between a reporter molecule and a suppressor molecule of an interactive double marker, and the extension reaction in step (d) is carried out in the presence of a nucleotide that there is the other between the reporter molecule and the suppressor molecule, thereby incorporating the marker on the extended ribbon; wherein the hybridization between the SO and the extended ribbon induces change in the signal from the interactive double marker, to provide the detectable signal.
[0009]
Method, according to claim 1, characterized by the fact that the SO comprises an FRET (fluorescence resonance energy transfer) acceptor, and the hybridization in step (e) is carried out in the presence of an intercalating dye; wherein the hybridization between the SO and the extended ribbon induces change in the signal from the SO acceptor, to provide the detectable signal.
[0010]
Method according to claim 1, characterized by the fact that the PTO and / or the CTO is blocked at its 3 'end to prevent its extension.
[0011]
Method according to claim 1, characterized by the fact that it further comprises the step of providing a detectable signal between steps (e) and (f) by fusing the hybridization resulting from step (e), or by fusing and hybridizing the hybridization resulting from step (e); wherein step (f) is performed by detecting the signal to determine the presence of the extended tape.
[0012]
Method according to claim 1, characterized by the fact that it further comprises the step of providing and detecting a detectable signal after step (f) by fusing the hybridization resulting from step (e), or by fusing and hybridizing the resulting hybridization of step (e), whereby the presence of the extended tape is determined once more.
[0013]
Method according to claim 1, characterized by the fact that it also comprises the denaturation step between steps (d) and (e).
[0014]
Method according to claim 1, characterized by the fact that it also comprises repeating all or some of the steps (a) - (f) with denaturation between repetition cycles.
[0015]
Method according to claim 14, characterized by the fact that it also comprises repeating steps (a) - (e) with denaturation between repetition cycles, and fusion of the hybridization resulting from step (e), or fusion and hybridization of the hybridization resulting from step (e), to provide a detectable signal; wherein step (f) is performed by detecting the signal to determine the presence of the extended tape.
[0016]
Method according to claim 1, characterized by the fact that steps (a) - (f) are carried out in a reaction vessel, or some of steps (a) - (f) are carried out in separate reaction vessels.
[0017]
Method according to claim 1, characterized in that it is performed to detect at least two types of target nucleic acid sequences; wherein the upstream oligonucleotide comprises at least two types of oligonucleotides, the PTO comprises at least two types of the PTOs, the CTO comprises at least two types of the CTOs, and the SO comprises at least two types of the SOs.
[0018]
Method according to claim 1, characterized in that the target nucleic acid sequence comprises a variation of nucleotide.
[0019]
Method according to any one of claims 1 to 18, characterized in that it is carried out in the presence of a downstream initiator.
[0020]
Kit for detecting a target nucleic acid sequence of a DNA, or a mixture of nucleic acids, by a PCE-SH assay (PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization), for use in carrying out the method as defined in any of claims 1 to 19, characterized by the fact that it comprises: (a) a probe and target oligonucleotide (PTO); wherein the PTO comprises (i) a 3 'target portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence, and (ii) a 5' labeling portion comprising a non-complementary nucleotide sequence target nucleic acid; wherein the 3 'targeting portion of the PTO is hybridized to the target nucleic acid sequence, and the 5' targeting portion is not hybridized to the target nucleic acid sequence; (b) an upstream oligonucleotide comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence; wherein the upstream oligonucleotide is located upstream of the PTO; wherein the upstream oligonucleotide, or its extended ribbon, induces cleavage of the PTO by an enzyme having a 5 'nucleasse activity, such that the cleavage releases a fragment comprising the 5' tag portion, or a part of the tag portion -5 'from the PTO; (c) a capture and modeling oligonucleotide (CTO); wherein the CTO comprises, in a 3 'to 5' direction, (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion, or a portion of the 5' labeling portion of the PTO, and (ii) a modeling portion comprising a nucleotide sequence not complementary to the 5 'tagging portion and the 3' targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; wherein the fragment hybridized to the capture portion of the CTO is extended to form an extended ribbon comprising an extended sequence complementary to the modeling portion of the CTO, thereby forming an extended duplex; wherein the CTO is not immobilized on a solid substrate; and (d) a signaling oligonucleotide (SO); wherein the SO comprises a sequence complementary to the extended sequence of the extended tape, and at least one marker; the SO provides a signal detectable by hybridization with the extended sequence of the extended tape; wherein the SO is blocked at its 3 'end to prevent its extension; wherein the SO is not immobilized on a solid substrate; wherein the kit comprises (i) the marker attached to the SO, (ii) a combination of the marker attached to the SO and a marker attached to the PTO fragment, (iii) a combination of the marker attached to the SO and a marker to be incorporated into the extended ribbon, or (iv) a combination of the marker attached to the SO and an intercalating dye.
[0021]
Kit, according to claim 20, characterized by the fact that it further comprises an additional SO comprising a sequence complementary to the extended ribbon, the two SOs are hybridized with the ribbon extended in an adjacent manner, the two SOs each comprise a marker between a reporter molecule and a suppressor molecule of an interactive double marker.
[0022]
Kit according to claim 20, characterized by the fact that it further comprises an enzyme that has 5 'nuclease activity.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10731203B2|2020-08-04|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide hybridization assay

---

BR122019022355B1|2021-05-11|method and kit for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids through a ptocean assay

---

US11078525B2|2021-08-03|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage

---

BR112014021993B1|2022-01-11|METHODS AND KITS FOR DETECTION OF A NUCLEOTIDE VARIATION IN A TARGET NUCLEIC ACID SEQUENCE THROUGH A PTOCE ASSAY

---

BR112013027876B1|2021-06-08|methods for detecting a target nucleic acid sequence and kits for detecting a target nucleic acid sequence

---

KR101756975B1|2017-07-12|Detection of Target Nucleic Acid Sequence by PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Cleavage

---

EP3027772B1|2019-03-06|Method for determining snp genotype

---

NZ627919B2|2017-02-28|Detection of target nucleic acid sequence by pto cleavage and extension-dependent signaling oligonucleotide hybridization assay

同族专利:

---

公开号 | 公开日

---

RU2014133695A|2016-03-27|

---

US20180127812A1|2018-05-10|

---

IL233773D0|2014-09-30|

---

IL233773A|2018-12-31|

---

US9868980B2|2018-01-16|

---

AU2012368436A1|2014-08-21|

---

ZA201405463B|2015-12-23|

---

MX361903B|2018-12-18|

---

JP2015505470A|2015-02-23|

---

EP2809797A1|2014-12-10|

---

NO20140948A1|2014-10-30|

---

EP2809797A4|2015-09-09|

---

US10731203B2|2020-08-04|

---

CA2862488C|2018-11-20|

---

CN106011234B|2019-11-12|

---

JP6005180B2|2016-10-12|

---

US20150072887A1|2015-03-12|

---

AU2016204887B2|2018-01-25|

---

KR20130101952A|2013-09-16|

---

SG11201404349YA|2014-08-28|

---

CN104145029A|2014-11-12|

---

WO2013115442A1|2013-08-08|

---

CN104145029B|2016-06-01|

---

KR101832867B1|2018-03-02|

---

KR20140112060A|2014-09-22|

---

CN106011234A|2016-10-12|

---

RU2608501C2|2017-01-18|

---

AU2012368436B2|2016-05-12|

---

CA2862488A1|2013-08-08|

---

MX2014009403A|2015-07-06|

---

NZ627919A|2016-11-25|

---

AU2016204887A1|2016-07-28|

---

EP2809797B1|2018-11-28|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US5210015A|1990-08-06|1993-05-11|Hoffman-La Roche Inc.|Homogeneous assay system using the nuclease activity of a nucleic acid polymerase|

---

US5541311A|1992-12-07|1996-07-30|Third Wave Technologies, Inc.|Nucleic acid encoding synthesis-deficient thermostable DNA polymerase|

---

US5538848A|1994-11-16|1996-07-23|Applied Biosystems Division, Perkin-Elmer Corp.|Method for detecting nucleic acid amplification using self-quenching fluorescence probe|

---

US6562611B1|1996-11-29|2003-05-13|Third Wave Technologies, Ins.|FEN-1 endonucleases, mixtures and cleavage methods|

---

GB9812768D0|1998-06-13|1998-08-12|Zeneca Ltd|Methods|

---

JP4724380B2|1999-04-20|2011-07-13|独立行政法人産業技術総合研究所|Nucleic acid probe used in nucleic acid measurement method and data analysis method|

---

US6322980B1|1999-04-30|2001-11-27|Aclara Biosciences, Inc.|Single nucleotide detection using degradation of a fluorescent sequence|

---

US7381532B2|1999-10-29|2008-06-03|Stratagene California|Compositions and methods for the detection of a nucleic acid using a cleavage reaction|

---

US7118860B2|1999-10-29|2006-10-10|Stratagene California|Methods for detection of a target nucleic acid by capture|

---

US7585632B2|1999-10-29|2009-09-08|Hologic, Inc.|Compositions and methods for the detection of a nucleic acid using a cleavage reaction|

---

AT497018T|2000-05-19|2011-02-15|Eragen Biosciences Inc|MATERIALS AND METHODS FOR DETECTING NUCLEIC ACIDS|

---

US6893819B1|2000-11-21|2005-05-17|Stratagene California|Methods for detection of a nucleic acid by sequential amplification|

---

US7678541B2|2000-11-21|2010-03-16|Hologic, Inc.|Methods and compositions for the detection of a nucleic acid using a non-invasive cleavage reaction|

---

US7309573B2|2000-11-21|2007-12-18|Stratagene California|Methods for detection of a nucleic acid by sequential amplification|

---

WO2003033741A1|2001-10-16|2003-04-24|Aclara Biosciences, Inc.|Universal e-tag primer and probe compositions and methods|

---

WO2003070984A1|2002-02-15|2003-08-28|Somalogic, Inc.|Methods and reagents for detecting target binding by nucleic acid ligands|

---

GB0205455D0|2002-03-07|2002-04-24|Molecular Sensing Plc|Nucleic acid probes, their synthesis and use|

---

US9261460B2|2002-03-12|2016-02-16|Enzo Life Sciences, Inc.|Real-time nucleic acid detection processes and compositions|

---

US8206904B2|2002-12-18|2012-06-26|Third Wave Technologies, Inc.|Detection of nucleic acids|

---

WO2005010199A2|2003-07-16|2005-02-03|Geneohm Sciences, Inc.|Invasive cleavage reaction with electrochemical readout|

---

US20050142595A1|2003-11-07|2005-06-30|U.S. Genomics, Inc.|Intercalator FRET donors or acceptors|

---

WO2005059548A1|2003-12-19|2005-06-30|Kankyo Engineering Co., Ltd.|Novel mixtures for assaying nucleic acid, novel method of assaying nucleic acid with the use of the same and nucleic acid probe to be used therefor|

---

CA2497324A1|2004-02-17|2005-08-17|Affymetrix, Inc.|Methods for fragmenting and labelling dna|

---

US20060029954A1|2004-06-30|2006-02-09|Applera Corporation|Compositions and methods for identifying nucleotides in polynucleotide sequences|

---

WO2006004949A1|2004-06-30|2006-01-12|Applera Corporation|Compositions and methods for detecting and quantitating polynucleotide sequences|

---

EP1885890A4|2005-05-26|2010-01-20|Univ Boston|Quantification of nucleic acids and proteins using oligonucleotide mass tags|

---

EP1907586A2|2005-07-15|2008-04-09|Applera Corporation|Detection of nucleic acid amplification|

---

EP2118310B1|2006-12-29|2013-03-06|Applied Biosystems, LLC|Systems and methods for detecting nucleic acids|

---

JP2010514450A|2006-12-29|2010-05-06|アプライドバイオシステムズインコーポレイテッド|Nucleic acid detection method and system|

---

FI20075124A0|2007-02-21|2007-02-21|Valtion Teknillinen|Method and test kit for detection of nucleotide variations|

---

KR20090067334A|2007-12-21|2009-06-25|주식회사 씨젠|Methods for detecting target nucleic acid using nuclease activity of nucleic acid polymerase|

---

JP5651022B2|2008-03-15|2015-01-07|ホロジック，インコーポレーテッド|Compositions and methods for analyzing nucleic acid molecules in amplification reactions|

---

US9234232B2|2008-07-31|2016-01-12|Oxitec Limited|Multiplex amplification and detection|

---

AU2009282246B2|2008-08-15|2015-06-25|Cascade Biosystems, Inc.|Detecting nucleic acid|

---

GB0818355D0|2008-10-08|2008-11-12|Smart Patents Ltd|Universal beverage container marker|

---

CN102216472A|2008-11-13|2011-10-12|里博克斯艾克斯有限公司|Rna detection method|

---

EP2256215A1|2009-04-30|2010-12-01|Steffen Mergemeier|Assay system using a nuclease activity of a nucleic acid polymerase|

---

EP2248915B1|2009-05-05|2013-09-18|Qiagen GmbH|Detection of multiple nucleic acid sequences in a reaction cartridge|

---

WO2011027966A2|2009-09-03|2011-03-10|Seegene, Inc.|Td probe and its uses|

---

JP5822843B2|2009-12-21|2015-11-24|シージーン アイエヌシー|TSG primer target detection|

---

EP2569449A4|2010-05-14|2013-12-04|Life Technologies Corp|Identification of nucleic acids|

---

MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

US9850524B2|2011-05-04|2017-12-26|Seegene, Inc.|Detection of target nucleic acid sequences by PO cleavage and hybridization|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|

---

JP5976849B2|2012-03-05|2016-08-24|シージーン アイエヌシー|Detection of nucleotide mutations in target nucleic acid sequences by PTO cleavage and extension assays {Detection of Nucleotide Variation on Target Nucleic Acid Sequence PTO Cleavage and Extension Assay}|

---

US9683259B2|2012-04-19|2017-06-20|Seegene, Inc.|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide cleavage|

---

CN104520711B|2013-05-30|2017-09-19|秀根科技株式公司|The real-time quantitative and method for qualitative analysis of biological substance|

---

WO2015147370A1|2014-03-28|2015-10-01|Seegene, Inc.|Detection of target nucleic acid sequences using different detection temperatures|

---

EP3230475A4|2014-12-09|2018-07-18|Seegene, Inc.|Differentiation of signals for target nucleic acid sequences|

---

DK3237636T3|2014-12-22|2021-01-25|Anapa Biotech As|Double-quenching analysis for multiplex detection of target nucleic acids|

---

AU2016356474A1|2015-11-20|2018-06-21|Seegene, Inc.|Method for calibrating a data set of a target analyte|

---

KR101961642B1|2016-04-25|2019-03-25|진매트릭스|A method for detecting target nucleic acid sequence using cleaved complementary tag fragment and a composition therefor|

---

KR102218776B1|2016-06-10|2021-02-22|주식회사 씨젠|Method of providing tagging oligonucleotide|

---

WO2018050824A1|2016-09-15|2018-03-22|Roche Diagnostics Gmbh|Methods for performing multiplexed pcr|

---

US20210102236A1|2017-03-28|2021-04-08|Seegene, Inc.|Analytical Signal For Determination Of The Presence Of A Target Nucleic Acid Sequence|

---

CN108823287B|2017-04-28|2019-04-12|厦门大学|A method of detection target nucleic acid sequence|

---

US20200270679A1|2017-09-29|2020-08-27|Seegene, Inc.|Detection of target nucleic acid sequences by pto cleavage and extension-dependent extension assay|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according art. 34 industrial property law|

---

2019-07-30| B06U| Preliminary requirement: requests with searches performed by other patent offices: suspension of the patent application procedure|

---

2020-09-24| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application according art. 36 industrial patent law|

---

2021-02-09| B09A| Decision: intention to grant|

---

2021-03-23| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 03/07/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

KR10-2012-0010681|2012-02-02|

---

KR20120010681|2012-02-02|

---

KR10-2012-0028429|2012-03-20|

---

KR1020120028429A|KR20130101952A|2012-02-02|2012-03-20|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|

---

PCT/KR2012/005281|WO2013115442A1|2012-02-02|2012-07-03|Detection of target nucleic acid sequence by pto cleavage and extension-dependent signaling oligonucleotide hybridization assay|

---